Bartleby Sitemap - Textbook Solutions
All Textbook Solutions for Biology 2e
FtsZ proteins direct the formation of a ___________ that will eventually form the new cell walls of the daughter cells. contractile ring cell plate cytoskeletom septumCompare and contrast a human somatic cell to a human gamete.What is the relationship between a genome, chromosomes, and genes?Eukaryotic chromosomes are thousands of times longer than a typical cell. Explain how chromosomesBriefly describe the events that occur in each phase of interphase.Chemotherapy drugs such as vincristine (derived from Madagascar periwinkle plants) and colchicine (derived from autumn crocus plants) disrupt mitosis by binding to tubulin (the subunit of microtubules) and interfering with microtubule assembly and disassembly. Exactly what mitotic structure is targeted by these drugs and what effect would that have on cell division?Describe the similarities and differences between the cytokinesis mechanisms found in animal cells versus those in plant cells.List some reasons why a cell that has just completed cytokinesis might enter the G0 phase instead of the G1 phase.What cell-cycle events will be affected in a cell that produces mutated (non-functional) cohesin protein?Describe the general conditions that must be met at each of the three main cell-cycle checkpoints.Compare and contrast the roles of the positive cell-cycle regulators negative regulators.What steps are necessary for Cdk to become fully active?Rb is a negative regulator that blocks the cell cycle at the G1 checkpoint until the cell achieves a requisite size. What molecular mechanism does Rb employ to halt the cell cycle?Outline the steps that lead to a cell becoming cancerous.Explain the difference between a proto-oncogene and a tumor-suppressor gene.List the regulatory mechanisms that might be lost in a cell producing faulty p53.______ can trigger apoptosis if certain cell-cycle events fail. How does this regulatory outcome benefit a multicellular organism?Name the common components of eukaryotic cell division and binary fission.Describe how the duplicated bacterial chromosomes are distributed into new daughter cells without the direction of the mitotic spindle.Figure 11.9 If a mutation occurs so that a fungus is no longer able to produce a minus mating type, will it still be able to reproduce?Meiosis usually produces___daughter___ cells. two haploid two diploid four haploid four diploidWhat structure is most important in forming the tetrads? centromere synaptonemal complex chiasma kinetochoreAt which stage of meiosis are sister chromatids separated from each other? prophase I prophase II anaphase I anaphase IIAt metaphase I, homologous chromosomes are connected only at what structures? chiasmata recombination nodules microtubules kinetochoresWhich of the following is not true in regard to crossover? Spindle microtubules guide the transfer of DNA across the synaptonemal complex Nonsister chromatids exchange genetic material Chiasmata are formed Recombination nodules mark the crossover point.What phase of mitotic interphase is missing from meiotic interkinesis? G0 phase G1 phase S phase G2 phaseThe part of meiosis that is similar to mitosis is ___________ . meiosis I anaphase I meiosis II interkinesisIf a muscle cell of atypical organism has 32 chromosomes, how many chromosomes will be in a gamete of that same organism? 8 16 32 64Which statement best describes the genetic content of the two daughter cells in prophase II of meiosis? haploid with one copy of each gene haploid with two copies of each gene diploid with two copies of each gene diploid with four copies of each geneThe pea plants used in Mendel’s genetic inheritance studies were di pie id, with 14 chromosomes in somatic cells. Assuming no crossing over events occur, how many unique gametes could one pea plant produce? 23 128 196 16,384How do telophase I and telophase II differ during meiosis in animal cells? Cells remain diploid at the end of telophase I, but are haploid at the end of telophase II Daughter cells form a cell plate to divide during telophase I. but divide by cytokinesis during telophase II. Cells enter interphase after telophase I, but not after telophase II Chromosomes can remain condensed at the end of telophase k but decondense after telophase II.What is a likely evolutionary advantage of sexual reproduction over asexual reproduction? Sexual reproduction involves fewer steps There is a lower chance of using up the resources in a given environment Sexual reproduction results in variation in the offspring Sexual reproduction is more cost-effective.Which type of life cycle has both a haploid and diploid multicellular stage? asexual life cycles most animal life cycles most fungal life cycles alternation of generationsWhat is the ploidy of the most conspicuous form of most fungi? diploid haploid alternation of generations asexualA diploid, multicellular life-cycle stage that gives rise to haploid cells by meiosis is called a sporophyte gametophyte spore gameteHydras and jellyfish both live in a freshwater lake that is slowly being acidified by the runoff from a chemical plant built upstream. Which population is predicted to be better able to cope with the changing environment? jellyfish hydra The populations will be equally able to cope Both populations will die.Many farmers are worried about the decreasing genetic diversity of plants associated with generations of artificial selection and inbreeding. Why is limiting random sexual reproduction of food crops concerning? Mutations during asexual reproduction decrease plant fitness Consumers do not trust identical-appearing produce Larger portions of the plant populations are susceptible to the same diseases Spores are not viable in an agricultural setting.Describe the process that results in the formation of a tetrad.Explain how the random alignment of homologous chromosomes during metaphase I contributes to the variation in gametes produced by meiosis.What is the function of the fused kinetochore found on sister chromatids in prometaphase I?In a comparison of the stages of meiosis to the stages of mitosis, which stages are unique to meiosis and which stages have the same events in both meiosis and mitosis?Why would an individual with a mutation that prevented the formation of recombination nodules be considered less fit than other members of its species?Does crossing over occur during prophase II? From an evolutionary perspective, why is this advantageous?List and briefly describe the three processes that lead to variation in offspring with the same parents.Animals and plants both have diploid and haploid cells. How does the animal life cycle differ from the alternation of generations exhibited hy plants?Explain why sexual reproduction is beneficial to a population but can be detrimental to an individual offspring.How does the role of meiosis in gamete production differ between organisms with a diploid-dominant life cycle and organisms with an alternation of generations life cycle?How do organisms with haploid-dominant life cycles ensure continued genetic diversification in offspring without using a meiotic process to make gametes?Figure 12.5 In pea plants, round peas (R) are dominant to wrinkled peas (r). You do a test cross between a pea plant with wrinkled peas (genotype rr) and a plant of unknown genotype that has round peas. You end up with three plants, all which have round peas. From this data, can you tell if the round pea parent plant is homozygous dominant or heterozygous? If the round pea parent plant is heterozygous, what is the probability that a random sample of 3 progeny peas will all be round?Figure 12.6 What are the genotypes of the individuals labeled 1, 2, and 3?Figure 12.12 What ratio of offspring would result from a cross between a white-eyed male and a female that is heterozygous for red eye color?Figure 12.16 In pea plants, purple flowers (P) are dominant to white flowers (p) and yellow peas (Y) are dominant to green peas (y). What are the possible genotypes and phenotypes for a cross between PpYY and ppYy pea plants? How many squares do you need to do a Punnett square analysis of this cross?Mendel performed hybridizations by transferring pollen from the_____ of the male plant to the female ova. a. anther b. pistil c. stigma d. seedWhich is one of the seven characteristics that Mendel observed in pea plants? flower size seed texture leaf shape stem colorImagine you are performing a cross involving seed color in garden pea plants. What Fi offspring would you expect if you cross true-breeding parents with green seeds and yellow seeds? Yellow seed color is dominant over green. 100 percent yellow-green seeds 100 percent yellow seeds 50 percent yellow, 50 percent green seeds 25 percent green, 75 percent yellow seedsConsider a cross to investigate the pea pod texture trait, involving constricted or inflated pods. Mendel found that the traits behave according to a dominant/ recessive pattern in which inflated pods were dominant. If you performed this cross and obtained 650 inflated-pod plants in the F2 generation, approximately how many constricted-pod plants would you expect to have? 600 165 217 468A scientist pollinates a true-breeding pea plant with violet, terminal flowers with pollen from a true- breeding pea plant with white, axial flowers. Which of the following observations would most accurately describe the F2 generation? 75% violet flowers; 75% terminal flowers 75% white flowers in a terminal position 75% violet flowers; 75% axial flowers 75% violet flowers in an axial positionThe observable traits expressed by an organism are described as its. phenotype genotype alleles zygoteA recessive trait will be observed in individuals that are for that trait. heterozygous homozygous or heterozygous homozygous diploidIf black and white true-breeding mice are mated and the result is all gray offspring, what inheritance pattern would this be indicative of? dominance codominance multiple alleles incomplete dominanceThe ABO blood groups in humans are expressed as the IAlB, and IAalleles. The allele encodes the A blood group antigen, lBencodes B, and i encodes O. Both A and B are dominant to O. If a heterozygous blood type A parent (IAi) and a heterozygous blood type B parent (IBi) mate, one quarter of their offspring will have AB blood type (IAIB) in which both antigens are expressed equally. Therefore, ABO blood groups are an example of: multiple alleles and incomplete dominance codominance and incomplete dominance incomplete dominance only multiple alleles and codominanceIn a mating between two individuals that are heterozygous for a recessive lethal allele that is expressed in utero, what genotypic ratio (homozygous dominant: heterozygous:homozygous recessive) would you expect to observe in the offspring? a. 1:2:1 b. 3:1:1 c. 1:2:0 d. 0:2:1If the allele encoding polydactyly (six fingers) is dominant why do most people have five fingers? Genetic elements suppress the polydactyl gene Polydactyly is embryonic lethal The sixth finger is removed at birth The polydactyl allele is very rare in the human population.A farmer raises black and white chickens. To his surprise, when the first generation of eggs hatch all the chickens are black with white speckles throughout their feathers. What should the farmer expect when the eggs laid after interbreeding the speckled chickens hatch? All the offspring will be speckled 75% of the offspring will be speckled, and 25% will be black 50% of the offspring will be speckled, 25% will be black, and 25% will be white 50% of the offspring will be black and 50% of the offspring will be white.Assuming no gene linkage, in a dihybrid cross of AABB x aabb with AaBb F1 heterozygotes, what is the ratio of the F1 gametes (AB, aB, Ab, ab) that will give rise to the F2 offspring? a. 1:1:1:1 b. 1:3:3:1 c. 1:2:2:1 d. 4:3:3:1The forked line and probability methods make use of what probability rule? test cross product rule monohybrid rule sum ruleHow many different offspring genotypes are expected in a trihybrid cross between parents heterozygous for all three traits when the traits behave in a dominant and recessive pattern? How many phenotypes? 64 genotypes: 16 phenotypes 16 genotypes; 64 phenotypes 8 genotypes; 27 phenotypes 27 genotypes; 8 phenotypesLabrador retriever's fur color is controlled by two alleles, E and B. Any dog with the ee genotype develops into a yellow lab, while B_E_ dogs become black labs and bbE_ dogs become chocolate labs. This is an example of.____ epistasis codominance incomplete dominance linkageWhich of the following situations does not follow the Law of Independent Assortment? A blond man and a brunette woman produce three offspring over time, all of who have blond hair A white cow crossed with a brown bull produces roan cattle Mating a hog with a sow produces six female piglets Men are more likely to experience hemophilia than women.Describe one of the reasons why the garden pea was an excellent choice of model system for studying inheritance.How would you perform a reciprocal cross for the characteristic of stem height in the garden pea?Mendel performs a cross using a true-breeding pea plant with round, yellow seeds and a true- breeding pea plant with green, wrinkled seeds. What is the probability that offspring will have green, round seeds? Calculate the probability for the F1 and F2 generations.Calculate the probability of selecting a heart or a face card from a standard deck of cards. Is this outcome more or less likely than selecting a heart suit face card?The gene for flower position in pea plants exists as axial or terminal alleles. Given that axial is dominant to terminal, list all of the possible F1 and F2 genotypes and phenotypes from a cross involving parents that are homozygous for each trait. Express genotypes with conventional genetic abbreviations.Use a Punnett square to predict the offspring in a cross between a dwarf pea plant (homozygous recessive) and a tall pea plant (heterozygous). What is the phenotypic ratio of the offspring?Can a human male be a carrier of red-green color blindness?Why is it more efficient to perform a test cross with a homozygous recessive donor than a homozygous dominant donor? How could the same information still he found with a homozygous dominant donor?Use the probability method to calculate the genotypes and genotypic proportions of a cross between AABBCc and Aabbcc parents.Explain epistatis in terms of its Greek-language roots “standing upon.”In Section 12.3, ''Laws of Inheritance," an example of epistasis was given for the summer squash. Cross white WAvYy heterozygotes to prove the phenotypic ratio of 12 white:3 yellow:l green that was given in the text.People with trisomy 21 develop Down’s syndrome. What law of Mendelian inheritance is violated in this disease? What is the most likely way this occurs?A heterozygous pea plant produces violet flowers and yellow, round seeds. Describe the expected genotypes of the gametes produced by Mendelian inheritance. If all three genes are found on the same arm of one chromosome should a scientist predict that inheritance patterns will follow Mendelian genetics?Figure 13.3 In a test cross for two characteristics such as the one shown here, can the predicted frequency of recombinant offspring be 60 percent? Why or why not?Figure 13.4 Which of the following statements is true? Recombination of the body color and red/ cinnabar eye alleles will occur more frequently than recombination of the alleles for wing length and aristae length. Recombination of the body color and aristae length alleles will occur more frequently than recombination of red/brown eye alleles and the aristae length alleles. Recombination of the gray/black body color and long/short aristae alleles will not occur. Recombination of the red/brown eye and long/short aristae alleles will occur more frequently than recombination of the alleles for wing length and body color.Figure 13.6 Which of the following statements about nondisjunction is true? Nondisjunction only results in gametes with n+1 or n-1 chromosomes. Nondisjunction occurring during meiosis II results in 50 percent normal gametes. Nondisjunction during meiosis I results in 50 percent normal gametes. Nondisjunction always results in four different kinds of gametes.X-linked recessive traits in humans (or in Drosophila) are observed. in more males than females in more females than males in males and females equally in different distributions depending on the traitThe first suggestion that chromosomes may physically exchange segments came from the microscopic identification of. synapsis sister chromatids chiasmata allelesWhich recombination frequency corresponds to independent assortment and the absence of linkage? 0 0.25 0.50 0.75Which recombination frequency corresponds to perfect linkage and violates the law of independent assortment? 0 0.25 0.50 0.75Which of the following codes describes position 12 on the long arm of chromosome 13? 13p12 13q12 12p13 12q13In agriculture, polyploid crops (like coffee, strawberries, or bananas) tend to produce more uniformity more variety larger yields smaller yieldsAssume a pericentric inversion occurred in one of two homologs prior to meiosis. The other homolog remains normal. During meiosis, what structure—it any—would these homologs assume in order to pair accurately along their lengths? V formation cruciform loop pairing would not be possibleThe genotype XXY corresponds to Klinefelter syndrome Turner syndrome Triplo-X Jacob syndromeAbnormalities in the number of X chromosomes tends to have milder phenotypic effects than the same abnormalities in autosomes because of ___________ . deletions nonhomologous recombination synapsis X inactivationBy definition, a pericentric inversion includes the ___________ . centromere chiasma telomere synapseExplain how the Chromosomal Theory of Inheritance helped to advance our understanding of genetics.Using diagrams, illustrate how nondisjunction can result in an aneuploid zygote.Figure 14.10 In eukaryotic cells, DNA and RNA synthesis occur in a separate compartment from protein synthesis. In prokaryotic cells, both processes occur together. What advantages might there be to separating the processes? What advantages might there be to having them occur together?Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?Figure 14.21 A fr am eshift mutation that results in the insertion of three nucleotides is often less deleterious than a mutation that results in the insertion of one nucleotide. Why?If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what would be the percentage of C? 27 percent 30 percent 23 percent 54 percentThe experiments by Hershey and Chase helped confirm that DNA was the hereditary material on the basis of the finding that: radioactive phage were found in the pellet radioactive cells were found in the supernatant radioactive sulfur was found inside the cell radioactive phosphorus was found in the cellBacterial transformation is a major concern in many medical settings. Why might health care providers be concerned? Pathogenic bacteria could introduce disease-causing genes in non-pathogenic bacteria Antibiotic resistance genes could be introduced to new bacteria to create “superbugs. ” Bacteriophages could spread DNA encoding toxins to new bacteria All of the above.DNA double helix does not have which of the following? antiparallel configuration complementary base pairing major and minor grooves uracilIn eukaryotes, what is the DNA wrapped around? single-stranded binding proteins sliding clamp polymerase histonesMeselson and Stahl's experiments proved that DNA replicates by which mode? conservative semi-conservative dispersive none of the aboveIf the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence: 3'-AATGCTAC-5' 3'-CATCGTAA-5' c. 3'-TTACGATG-5' d. 3’-GTAGCATT-5'How did Meselson and Stahl support Watson and Crick’s double-helix model? They demonstrated that each strand serves as a template tor synthesizing a new strand of DNA They showed that the DNA strands break and recombine without losing genetic material They proved that DNA maintains a double helix structure while undergoing semi conservative replication They demonstrated that conservative replication maintains the complementary base pairing of each DNA helix.Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligaseWhich of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments phosphodiester linkageIn which direction does DNA replication take place? 5'-3' 3'-5‘ 5‘ 3’A scientist randomly mutates the DNA of a bacterium. She then sequences the bacterium’s daughter cells, and finds that the daughters have many errors in their replicated DNA. The parent bacterium likely acquired a mutation in which enzyme? DNA ligase DNA pol II Primase DNA pol IThe ends of the linear chromosomes are maintained by helicase primase DNA pol telomeraseWhich of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicaseThe initial mechanism for repairing nucleotide errors in DNA is. mismatch repair DNA polymerase proofreading nucleotide excision repair thymine dimersA scientist creates fruit fly larvae with a mutation that eliminates the exonuclease function of DNA pol III. Which prediction about the mutational load in the adult fruit flies is most likely to be correct? The adults with the DNA pol III mutation will have significantly more mutations than average The adults with the DNA pol III mutation will have slightly more mutations than average The adults with the DNA pol III mutation will have the same number of mutations as average The adults with the DNA pol III mutation will have fewer mutations than average.Explain Griffith's transformation experiments What did he conclude from them?Why were radioactive sulfur and phosphorous used to label bacteriophage in Hershey and Chase’s experiments?When Chargaffwas performing his experiments, the tetranucleotide hypothesis, which stated that DNA was composed of GACT nucleotide repeats, was the most widely accepted view of DNA’s composition. How did Chargaff disprove this hypothesis?Provide a brief summary of the Sanger sequencing method.Describe the structure and complementary base pairing of DNA.Prokaryotes have a single circular chromosome while eukaryotes have linear chromosomes. Describe one advantage and one disadvantage to the eukaryotic genome packaging compared to the prokaryotes.How did the scientific community learn that DNA replication takes place in a semi-conservative fashion?Imagine the Meselson and Stahl experiments had supported conservative replication instead of semiconservative replication. What results would you predict to observe after two rounds of replication? Be specific regarding percent distributions of DNA incorporating 15N and 14N in the gradient.DNA replication is bidirectional and discontinuous; explain your understanding of those concepts.What are Okazaki fragments and how they are formed?If the rate of replication in a particular prokaryote is 900 nucleotides per second, how long would it take 1.2 million base pair genomes to make two copies?Explain the events taking place at the replication fork. If the gene for helicase is mutated, what part of replication will be affected?What is the role of a primer in DNA replication? What would happen if you forgot to add a primer in a tube containing the reaction mix for a DNA sequencing reaction?Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does this treatment work? Explain what occurs at the molecular level.How do the linear chromosomes in eukaryotes ensure that its ends are replicated completely?What is the consequence of mutation of a mismatch repair enzyme? How will this affect the function of a gene?An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?Figure 15.13 Errors in splicing are implicated in cancers and other human diseases. What kinds of mutations might lead to splicing errors? Think of different possible outcomes if splicing errors occur.Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis? Tetracycline would directly affect: tRNA binding to the ribosome ribosome assembly growth of the protein chain Chloramphenicol would directly affect tRNA binding to the ribosome ribosome assembly growth of the protein chainThe AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracyHow many nucleotides are in 12 mRNA codons? 12 24 36 43Which event contradicts the central dogma of molecular biology? Poly-A polymerase enzymes process mRNA in the nucleus Endonuclease enzymes splice out and repair damaged DNA Scientists use reverse transcriptase enzymes to make DNA from RNA Codons specifying amino acids are degenerate and universal.Which subunit of the E. coli polymerase confers specificity to transcription? a. b. c. d.The -10 and -35 regions of prokaryotic promoters are called consensus sequences because.__________ they are identical in all bacterial species they are similar in all bacterial species they exist in all organisms they have the same function in all organismsThree different bacteria species have the following consensus sequences upstream of a conserved gene. Species A Species B Species C -10 TAATAAT TTTAAT TATATT -35 TTGACA TTGGCC TTGAAA Table 15.2 Order the bacteria from most to least efficient initiation of gene transcription. A > B > C B > C > A C > B > A A > C > BWhich feature of promoters can be found in both prokaryotes and eukaryotes? GC box TATA box octamer box -10 and -35 sequencesWhat transcripts will be most affected by low levels of a-amanitin? 18S and 28S rRNAs pre-m RNAs 5S rRNAs and tRNAs other small nuclear RNAsHow do enhancers and promoters differ? Enhancers bind transcription factors to silence gene expression, while promoters activate transcription Enhancers increase the efficiency of gene expression, but are not essential for transcription. Promoter recognition is essential to transcription initiation. Promoters bind transcription factors to increase the efficiency of transcription. Enhancers bind RNA polymerases to initiate transcription. There is no difference. Both are transcription factor-binding sequences in DNA.Which pre-mRNA processing step is important for initiating translation? poly-A tail RNA editing splicing 7-methylguanosine capWhat processing step enhances the stability of pre-tRNAs and pre-rRNAs? methylation nucleotide modification cleavage splicingA scientist identifies a pre-mRNA with the following structure. What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail? 220bp 295bp 140bp 435bpThe RNA components of ribosomes are synthesized in the.____ cytoplasm nucleus nucleolus endoplasmic reticulumIn any given species, there are at least how many types of aminoacyl tRNA synthetases? 20 40 100 200A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.Discuss how degeneracy of the genetic code makes cells more robust to mutations.A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes.A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)A scientist observes that a cell has an RNA polymerase deficiency that prevents if from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.Chronic lymphocytic leukemia patients often harbor nonsense mutations in their spliceosome machinery. Describe how this mutation of the spliceosome would change the final location and sequence of a pre-mRNA.Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'Explain how single nucleotide changes can have vastly different effects on protein function.A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)Figure 16.5 In E. coli, the tip operon is on by default, while the lac operon is off. Why do you think that this is the case?Figure 16.7 In females, one of the two X chromosomes is inactivated during embryonic development because of epigenetic changes to the chromatin. What impact do you think these changes would have on nucleosome packing?Figure 16.13 An increase in phosphorylation levels of elF-2 has been observed in patients with neurodegenerative diseases such as Alzheimer’s, Parkinson's, and Huntington's. What impact do you think this might have on protein synthesis?Control of gene expression in eukaryotic cells occurs at which level(s)? only the transcriptional level epigenetic and transcriptional levels epigenetic, transcriptional, and translational levels epigenetic, transcriptional, post transcriptional, translational and post translational levelsPost-translational control refers to: regulation of gene expression after transcription regulation of gene expression after translation control of epigenetic activation period between transcription and translationHow does the regulation of gene expression support continued evolution of more complex organisms? Cells can become specialized within a multicellular organism Organisms can conserve energy and resources Cells grow larger to accommodate protein production Both A and B.If glucose is absent, but so is lactose, the lac operon will be. activated repressed activated, but only partially mutatedProkaryotic cells lack a nucleus. Therefore, the genes in prokaryotic cells are: all expressed, all of the time transcribed and translated almost simultaneously transcriptionally controlled because translation begins before transcription ends b and c are both trueThe a/a operon is an inducible operon that controls the production of the sugar arabinose. When arabinose is present in a bacterium it binds to the protein AraC, and the complex binds to the initiator site to promote transcription. In this scenario, AraC is a(n). activator inducer repressor operatorWhat are epigenetic modifications? the addition of reversible changes to histone proteins and DNA the removal of nucleosomes from the DNA the addition of more nucleosomes to the DNA mutation of the DNA sequenceWhich of the following are true of epigenetic changes? allow DNA to be transcribed move histones to open or close a chromosomal region are temporary all of the aboveThe binding of _____ is required for transcription to start. a protein DNA polymerase RNA polymerase a transcription factorWhat will result from the binding of a transcription factor to an enhancer region? decreased transcription of an adjacent gene increased transcription of a distant gene alteration of the translation of an adjacent gene initiation of the recruitment of RNA polymeraseA scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct? More transcripts will be made from Gene B Transcription of Gene A involves fewer transcription factors Enhancers control Gene B’s transcription Transcription of Gene A is more controlled than transcription of Gene B.Which of the following are involved in post transcriptional control? controlof RNAsplicing controlof RNA shuttling controlof RNA stability d. all of the aboveBinding of an RNA binding protein will the stability of the RNA molecule. increase decrease neither increase nor decrease either increase or decreaseAn unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bpIS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of the following is not an evolutionary advantage of alternative splicing? Alternative splicing increases diversity without increasing genome size Different gene isoforms can be expressed in different tissues Alternative splicing creates shorter mRNA transcripts Different gene isoforms can be expressed during different stages of development.Post-translational modifications of proteins can affect which of the following? protein function transcriptional regulation chromatin modification all of the aboveA scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.Cancer causing genes are called transformation genes tumor suppressor genes oncogenes mutated genesTargeted therapies are used in patients with a set gene expression pattern. A targeted therapy that prevents the activation of the estrogen receptor in breast cancer would be beneficial to which type of patient? patients who express the EGFR receptor in normal cells patients with a mutation that inactivates the estrogen receptor patients with lots of the estrogen receptor expressed in their tumor patients that have no estrogen receptor expressed in their tumorName two differences between prokaryotic and eukaryotic cells and how these differences benefit multicellular organisms.Describe how controlling gene expression will alter the overall protein levels in the cell.Describe how transcription in prokaryotic cells can be altered by external stimulation such as excess lactose in the environment.What is the difference between a repressible and an inducible operon?In cancer cells, alteration to epigenetic modifications turns off genes that are normally expressed. Hypothetically, how could you reverse this process to turn these genes back on?A scientific study demonstrated that rat mothering behavior impacts the stress response in their pups. Rats that were born and grew up with attentive mothers showed low activation of stress-response genes later in life, while rats with inattentive mothers had high activation of stress-response genes in the same situation. An additional study that swapped the pups at birth (i.e., rats born to inattentive mothers grew up with attentive mothers and vice versa) showed the same positive effect of attentive mothering. How do genetics and/or epigenetics explain the results of this study?Some autoimmune diseases show a positive correlation with dramatically decreased expression of histone deacetylase 9 (HDAC9, an enzyme that removes acetyl groups from histones). Why would the decreased expression of HDAC9 cause immune cells to produce inflammatory genes at inappropriate times?A mutation within the promoter region can alter transcription of a gene. Describe how this can happen.What could happen if a cell had too much of an activating transcription factor present?A scientist identifies a potential transcription regulation site 300bp downstream of a gene and hypothesizes that it is a repressor. What experiment (with results) could he perform to support this hypothesis?Describe how RBPs can prevent miRNAs from degrading an RNA molecule.How can external stimuli alter post-transcriptional control of gene expression?Protein modification can alter gene expression in many ways. Describe how phosphorylation of proteins can alter gene expression.Alternative forms of a protein can be beneficial or harmful to a cell. What do you think would happen if too much of an alternative protein bound to the 3' UTR of an RNA and caused it to degrade?Changes in epigenetic modifications alter the accessibility and transcription of DNA. Describe how environmental stimuli, such as ultraviolet light exposure, could modify gene expression.A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?New drugs are being developed that decrease DNA methylation and prevent the removal of acetyl groups from histone proteins. Explain how these drugs could affect gene expression to help kill tumor cells.How can understanding the gene expression pattern in a cancer cell tell you something about that specific form of cancer?Figure 17.7 You are working in a molecular biology lab and, unbeknownst to you, your lab partner left the foreign genomic DNA that you are planning to clone on the lab bench overnight instead of storing it in the freezer. As a result, it was degraded by nucleases, but still used in the experiment. The plasmid, on the other hand, is fine. What results would you expect from your molecular cloning experiment? There will be no colonies on the bacterial plate. There will be blue colonies only. There will be blue and white colonies. The will be white colonies only.Figure 17.8 Do you think Dolly was a Finn-Dorset or a Scottish Blackface sheep?Figure 17.15 In 2011, the United States Preventative Services Task Force recommended against using the PSA test to screen healthy men for prostate cancer. Their recommendation is based on evidence that screening does not reduce the risk of death from prostate cancer. Prostate cancer often develops very slowly and does not cause problems, while the cancer treatment can have severe side effects. The PCA3 test is considered to be more accurate, but screening may still result in men who would not have been harmed by the cancer itself suffering side effects from treatment. What do you think? Should all healthy men be screened for prostate cancer using the PCA3 or PSA test? Should people in general be screened to find out if they have a genetic risk for cancer or other diseases?GMOs are created by. generating genomic DNA fragments with restriction endonucleases introducing recombinant DNA into an organism by any means overexpressing proteins in E. coli all of the aboveGene therapy can be used to introduce foreign DNA into cells. for molecular cloning by PCR of tissues to cure inheritable disease all of the aboveInsulin produced by molecular cloning is of pig origin is a recombinant protein is made by the human pancreas is recombinant DNABt toxin is considered to be. a gene for modifying insect DNA an organic insecticide produced by bacteria useful for humans to fight against insects a recombinant proteinThe Flavr Savr Tomato: is a variety of vine-ripened tomato in the supermarket was created to have better flavor and shelf life does not undergo soft rot all of the abovegenerated after a cDNA library is made unique sequences in the genome useful for mapping using sequence information all of the aboveLinkage analysis. is used to create a physical map is based on the natural recombination process requires radiation hybrid mapping involves breaking and rejoining of DNA artificiallyGenetic recombination occurs by which process? independent assortment crossing over chromosome segregation sister chromatidsIndividual genetic maps in a given species are: genetically similar genetically identical genetically dissimilar not useful in species analysisInformation obtained by microscopic analysis of stained chromosomes is used in: radiation hybrid mapping sequence mapping RFLP mapping cytogenetic mappingThe chain termination method of sequencing uses labeled ddNITPs uses only dideoxynucleotides uses only deoxynucleotides uses labeled dNTPsWhole-genome sequencing can be used for advances in: the medical field agriculture biofuels all of the aboveSequencing an individual person’s genome is currently possible could lead to legal issues regarding discrimination and privacy could help make informed choices about medical treatment all of the aboveWhat is the most challenging issue facing genome sequencing? the inability to develop fast and accurate sequencing techniques the ethics of using information from genomes at the individual level the availability and stability of DNA all of the aboveGenomics can be used in agriculture to generate new hybrid strains improve disease resistance improve yield all of the aboveGenomics cam be used on a personal level to: decrease transplant rejection predict genetic diseases that a person may have inherited determine the risks of genetic diseases for an individual’s children all of the aboveWhat is a biomarker? the color coding of different genes a protein that is uniquely produced in a diseased state a molecule in the genome or proteome a marker that is genetically inheritedA protein signature is: the path followed by a protein after it is synthesized in the nucleus the path followed by a protein in the cytoplasm a protein expressed on the cell surface a unique set of proteins present in a diseased stateDescribe the precess of Southern blottingA researcher wants to study cancer cells from a patient with breast cancer. Is cloning the cancer cells an option?How would a scientist introduce a gene for herbicide resistance into a plant?If you had a chance to get your genome sequenced, what are some questions you might be able to have answered about yourself?Why is so much effort being poured into genome mapping applications?How could a genetic map of the human genome help find a cure for cancer?Explain why metagenomics is probably the most revolutionary application of genomics.How can genomics be used to predict disease risk and treatment options?How has proteomics been used in cancer detection and treatment?What is personalized medicine?Figure 18.14 Which is most likely to survive, offspring with 2n+l chromosomes or offspring with 2n-l chromosomes?Figure 18.22 If two species eat a different diet but one of the food sources is eliminated and both species are forced to eat the same foods, what change in the hybrid zone is most likely to occur?Figure 18.23 Which of the following statements is false? Punctuated equilibrium is most likely to occur in a small population that experiences a rapid change in its environment. Punctuated equilibrium is most likely to occur in a large population that lives in a stable climate. Gradual speciation is most likely to occur in species that live in a stable climate. Gradual speciation and punctuated equilibrium both result in the evolution of new species.Which scientific concept did Charles Darwin and Alfred Wallace independently discover? mutation natural selection overbreeding sexual reproductionWhich of the following situations will lead to natural selection? The seeds of two plants land near each other and one grows larger than the other Two types of fish eat the same kind of food, and one is better able to gather food than the other Male lions compete for the right to mate with females, with only one possible winner all of the aboveWhich description is an example of a phenotype? A certain duck has a blue beak A mutation occurred to a flower Most cheetahs live solitary lives both a and cWhich situation is most likely an example of convergent evolution? Squid and humans have eyes similar in structure Worms and snakes both move without legs Some bats and birds have wings that allow them to fly all of the aboveWhich situation would most likely lead to allopatric speciation? Flood causes the formation of a new lake A storm causes several large trees to fall down A mutation causes a new trait to develop An injury causes an organism to seek out a new food source.What is the main difference between dispersal and vicariance? One leads to allopatric speciation, whereas the other leads to sympatric speciation One involves the movement of the organism, and the other involves a change in the environment One depends on a genetic mutation occurring, and the other does not One involves closely related organisms, and the other involves only individuals of the same species.Which variable increases the likelihood of allopatric speciation taking place more quickly? lower rate of mutation longer distance between divided groups increased instances of hybrid formation equivalent numbers of individuals in each populationWhat is the main difference between autopolyploid and allopolyploid? the number of chromosomes the functionality of the chromosomes the source of the extra chromosomes the number of mutations in the extra chromosomesWhich reproductive combination produces hybrids? when individuals of the same species in different geographical areas reproduce when any two individuals sharing the same habitat reproduce when members of closely related species reproduce when offspring of the same parents reproduceWhich condition is the basis for a species to be re productively isolated from other members? It does not share its habitat with related species It does not exist out of a single habitat It does not exchange genetic information with other species It does not undergo evolutionary changes for a significant period of time.Which situation is not an example of a prezygotic barrier? Two species of turtles breed at different times of the year Two species of flowers attract different pollinators Two species of birds display different mating dances Two species of insects produce infertile offspring.Which term is used to describe the continued divergence of species based on the low fitness of hybrid offspring? reinforcement fusion stability punctuated equilibriumWhich components of speciation would be least likely to be a part of punctuated equilibrium? a division of populations a change in environmental conditions ongoing gene flow among all individuals a large number of mutations taking place at onceIf a person scatters a handful of garden pea plant seeds in one area, how would natural selection work in this situation?Why do scientists consider vestigial structures evidence for evolution?How does the scientific meaning of “theory” differ from the common vernacular meaning?Explain why the statement that a monkey is more evolved than a mouse is incorrect.Why do island chains provide ideal conditions for adaptive radiation to occur?Two species of fish had recently undergone sympatric speciation. The males of each species had a different coloring through which the females could identify and choose a partner from her own species. After some time, pollution made the lake so cloudy that it was hard for females to distinguish colors. What might take place in this situation?Why can polyploidy individuals lead to speciation fairly quickly?What do both rate of speciation models have in common?Describe a situation where hybrid reproduction would cause two species to fuse into one.Figure 19.2 In plants, violet flower color (V) is dominant over white (v). If p = .8 and q = 0.2 in a population of 500 plants, how many individuals would you expect to be homozygous dominant (VV), heterozygous (Vv), and homozygous recessive (vv)? How many plants would you expect to have violet flowers, and how many would have white flowers?Figure 19.4 Do you think genetic drift would happen more quickly on an island or on the mainland?Figure 19.8 In recent years, factories have become cleaner, and less soot is released into the environment. What impact do you think this has had on the distribution of moth color in the population?What is the difference between micro- and macroevolution? Microevolution describes the evolution of small organisms, such as insects, while macroevolution describes the evolution of large organisms, like people and elephants Microevolution describes the evolution of microscopic entities, such as molecules and proteins, while macroevolution describes the evolution of whole organisms Microevolution describes the evolution of organisms in populations, while macroevolution describes the evolution of species over long periods of time Microevolution describes the evolution of organisms over their lifetimes, while macroevolution describes the evolution of organisms over multiple generations.Population genetics is the study of: how selective forces change the allele frequencies in a population over time the genetic basis of population-wide traits whether traits have a genetic basis the degree of inbreeding in a populationWhich of the following populations is not in Hardy- Weinberg equilibrium? a population with 12 homozygous recessive individuals (yy), 8 homozygous dominant individuals (YY), and 4 heterozygous individuals (Yy) a population in which the allele frequencies do not change over time p2 + 2pq + q2 = 1 a population undergoing natural selectionOne of the original Amish colonies rose from a ship of colonists that came from Europe. The ship s captain, who had polydactyly, a rare dominant trait, was one of the original colonists. Today, we see a much higher frequency of polydactyly in the Amish population. This is an example of: natural selection genetic drift founder effect b and cWhen male lions reach sexual maturity, they leave their group in search of a new pride. This can alter the allele frequencies of the population through which of the following mechanisms? natural selection genetic drift gene flow random matingWhich of the following evolutionary forces can introduce new genetic variation into a population? natural selection and genetic drift mutation and gene flow natural selection and nonrandom mating mutation and genetic driftWhat is assortative mating? when individuals mate with those who are similar to themselves when individuals mate with those who are dissimilar to themselves when individuals mate with those who are the most fit in the population when individuals mate with those who are least fit in the populationWhen closely related individuals mate with each other, or inbreed, the offspring are often not as fit as the offspring of two unrelated individuals. Why? Close relatives are genetically incompatible The DNA of close relatives reacts negatively in the offspring Inbreeding can bring together rare, deleterious mutations that lead to harmful phenotypes Inbreeding causes normally silent alleles to be expressed.What is a cline? the slope of a mountain where a population lives the degree to which a mutation helps an individual survive the number of individuals in the population gradual geographic variation across an ecological gradientWhich type of selection results in greater genetic variance in a population? stabilizing selection directional selection diversifying selection positive frequency-dependent selectionWhen males and females of a population look or act differently, it is referred to as. sexual dimorphism sexual selection diversifying selection a clineThe good genes hypothesis is a theory that explains what? why more fit individuals are more likely to have more offspring why alleles that confer beneficial traits or behaviors are selected for by natural selection why some deleterious mutations are maintained in the population why individuals of one sex develop impressive ornamental traitsSolve for the genetic structure of a population with 12 homozygous recessive individuals (yy), 8 homozygous dominant individuals (YY), and 4 heterozygous individuals (Yy).Explain the Hardy-Weinberg principle of equilibrium theory.Imagine you are trying to test whether a population of flowers is undergoing evolution. You suspect there is selection pressure on the color of the flower: bees seem to cluster around the red flowers more often than the blue flowers. In a separate experiment, you discover blue flower color is dominant to red flower color. In a field, you count 600 blue flowers and 200 red flowers. What would you expect the genetic structure of the flowers to be?Describe a situation in which a population would undergo the bottleneck effect and explain what impact that would have on the population’s gene pool.Describe natural selection and give an example of natural selection at work in a population.Explain what a cline is and provide examples.Give an example of a trait that may have evolved as a result of the handicap principle and explain your reasoning.List the ways in which evolution can affect population variation and describe how they influence allele frequencies.Figure 20.6 At what levels are cats and dogs considered part of the same group?Figure 20.10 Which animals in this figure belong to a clade that includes animals with hair? Which evolved first, hair or the amniotic egg?Figure 20.11 What is the largest clade in this diagram?What is used to determine phylogeny? mutations DNA evolutionary history organisms on earthWhat do scientists in the field of systematics accomplish? discover new fossil sites organize and classify organisms name new species communicate among field biologistsWhich statement about the taxonomic classification system is correct? There are more domains than kingdoms Kingdoms are the top category of classification Classes are divisions of orders Subspecies are the most specific category of classification.On a phylogenetic tree, which term refers to lineages that diverged from the same place? sister taxa basal taxa rooted taxa dichotomous taxaWhich statement about analogies is correct? They occur only as errors They are synonymous with homologous traits. They are derived by similar environmental constraints. They are a form of mutation.What do scientists use to apply cladistics? homologous traits homoplasies analogous traits monophyletic groupsWhat is true about organisms that are a part of the same clade? They all share the same basic characteristics They evolved from a shared ancestor They usually fall into the same classification taxa They have identical phytogenies.Why do scientists apply the concept of maximum parsimony? to decipher accurate phytogenies to eliminate analogous traits to identify mutations in DNA codes to locate homoplasiesThe transfer of genes by a mechanism not involving asexual reproduction is called: meiosis web of life horizontal gene transfer gene fusionParticles that transfer genetic material from one species to another, especially in marine prokaryotes horizontal gene transfer lateral gene transfer genome fusion device gene transfer agentsWhat does the trunk of the classic phylogenetic tree represent? single common ancestor pool of ancestral organisms new species old speciesWhich phylogenetic model proposes that all three domains of life evolved from a pool of primitive prokaryotes? tree of life web of life ring of life network modelHow does a phylogenetic tree relate to the passing of time?Some organisms that appear very closely related on a phylogenetic tree may not actually be closely related. Why is this?List the different levels of the taxonomic classification system.