Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 20RQ
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation?
- Initiation factors would not be able to bind to mRNA
- The large ribosomal subunit would not be able to interact with itiRNA transcripts
- tRNAi-Met would not scan mRNA transcripts for the start codon
- elF-2 would not be able to interact with the small ribosomal subunit.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
How does the antibiotic streptomycin inhibit bacterial translation?
Multiple Choice
blocks elongation by preventing the large ribosomal subunit from binding to the small ribosomal subunit
interferes with the normal pairing of aminoacyl TRNAS and codons resulting in abnormal proteins
prevents the release of the initiator tRNA from the P site, blocking elongation
blocks termination by competitively inhibiting the binding of a release factor to the A site
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs in the eukaryotic cells it infects. Besides allowing degradation of the host’s mRNA, what step in translation of the host’s mRNAs does this prevent?
Group of answer choices
Movement of tRNA from the A site to the P site
tRNA binding to the A site
Recognition of the stop codon
Ribosome small subunit from binding mRNA
Movement of the tRNA from the P site to the A site
Chapter 16 Solutions
Biology 2e
Ch. 16 - Figure 16.5 In E. coli, the tip operon is on by...Ch. 16 - Figure 16.7 In females, one of the two X...Ch. 16 - Figure 16.13 An increase in phosphorylation levels...Ch. 16 - Control of gene expression in eukaryotic cells...Ch. 16 - Post-translational control refers to: regulation...Ch. 16 - How does the regulation of gene expression support...Ch. 16 - If glucose is absent, but so is lactose, the lac...Ch. 16 - Prokaryotic cells lack a nucleus. Therefore, the...Ch. 16 - The a/a operon is an inducible operon that...Ch. 16 - What are epigenetic modifications? the addition of...
Ch. 16 - Which of the following are true of epigenetic...Ch. 16 - The binding of _____ is required for transcription...Ch. 16 - What will result from the binding of a...Ch. 16 - A scientist compares the promoter regions of two...Ch. 16 - Which of the following are involved in post...Ch. 16 - Binding of an RNA binding protein will the...Ch. 16 - An unprocessed pre-mRNA has the following...Ch. 16 - IS. Alternative splicing has been estimated to...Ch. 16 - Post-translational modifications of proteins can...Ch. 16 - A scientist mutates elF-2 to eliminate its GTP...Ch. 16 - Cancer causing genes are called transformation...Ch. 16 - Targeted therapies are used in patients with a set...Ch. 16 - Name two differences between prokaryotic and...Ch. 16 - Describe how controlling gene expression will...Ch. 16 - Describe how transcription in prokaryotic cells...Ch. 16 - What is the difference between a repressible and...Ch. 16 - In cancer cells, alteration to epigenetic...Ch. 16 - A scientific study demonstrated that rat mothering...Ch. 16 - Some autoimmune diseases show a positive...Ch. 16 - A mutation within the promoter region can alter...Ch. 16 - What could happen if a cell had too much of an...Ch. 16 - A scientist identifies a potential transcription...Ch. 16 - Describe how RBPs can prevent miRNAs from...Ch. 16 - How can external stimuli alter...Ch. 16 - Protein modification can alter gene expression in...Ch. 16 - Alternative forms of a protein can be beneficial...Ch. 16 - Changes in epigenetic modifications alter the...Ch. 16 - A scientist discovers a virus encoding a Protein X...Ch. 16 - New drugs are being developed that decrease DNA...Ch. 16 - How can understanding the gene expression pattern...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The propeller of a World War Il fighter plane is 2.30 m in diameter. (a) What is its angular velocity in radian...
College Physics
4. Three groups of nonvascular plants are _______, ______, and _______. Three groups of seedless vascular plant...
Biology: Life on Earth
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth (11th Edition)
3. Trails that are derived from a common ancestor, like the bones of human arms and bird wings, are said to be_...
Biological Science (6th Edition)
Identify me theme or themes exemplified by (a) the sharp quills of a porcupine (b) the development of a multice...
Campbell Biology in Focus (2nd Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (6th Edition) - standalone book
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the precedingarrow_forwardEukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.arrow_forwardConsider gene expression in a prokaryotic or bacterial celI. Which of the following is true for translation or protein synthesis in this cell? Select all that apply. Small ribosomal subunit recognizes the 5' cap of the mRNA during initiation FMET charged tRNA binds to the P site during initiation The growing polypeptide is transferred from a TRNA in the P site to a charged TRNA in the A site RNA:RNA interactions are formedarrow_forward
- The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stoparrow_forwardDescribe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.arrow_forwardShown below is an eukaryotic gene. Assuming normal wild type RNA processing in a.cell, which of the following mature MRNAS could result in normal levels of functional synthesized proteins? Select all that apply Direction of transcription Promoter Template strand 5' Exon 4 Intron 3 Exon 3 Intron 2 Exon 2 Intron 1 Exon 1 3' 5' Coding strand Transcription start Transcription start 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA...AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4 Exon1-Exon2-Exon3-Exon4-.....AAAAarrow_forward
- Match the given statement to the corresponding type of ribonucleic acid.arrow_forwardWhat is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerasearrow_forwardWhich of the following characterize RNA polymerase Il transcriptional termination in eukaryotes? Endonuclease cleavage of the RNA transcript and 5' to 3' exonuclease activity a protein known as Ratl None of the provided answers, transcriptional termination occurs in prokaryotes. Recognition of the transcriptional stop codon by a release factor. Hairpin structure formation on the newly synthesized RNA molecule which disrupts the DNA-RNA hybrid at a poly-U RNA sequence Binding of the Rho protein.arrow_forward
- Determine whether each event occurs during initiation, elongation, or termination. Initiation Peptidyl transferase transfers the peptidyl group to water. In E. coli, EF-Tu hydrolyzes GTP. Elongation In E. coli, mRNA binds to the 30S ribosomal subunit. Answer Bank In prokaryotes, the Shine-Dalgarno sequence pairs with rRNA. In E. coli, EF-Tu delivers an aminoacyl-tRNA to the ribosome. Termination Translocation occurs. Initiator tRNA enters the P site.arrow_forwardEF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.arrow_forwardIdentify the correct recognition site for ribosomal subunit binding during translation. the 30s subunit binds to the 7-methylguanosine cap at the 3’ end of eukaryotic mRNA the 60s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eubacterial mRNA the 40s subunit binds to the 7-methylguanosine cap at the 5’ end of eukaryotic mRNA the 70s subunit binds to the “Shine-Dalgarno” sequence at the 5’ end of eukaryotic mRNA the 50s subunit binds to the 7-methylguanosine cap at the 3’ end of eubacterial mRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning 
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY