Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 16, Problem 11RQ
Which of the following are true of epigenetic changes?
- allow DNA to be transcribed
- move histones to open or close a chromosomal region
- are temporary
- all of the above
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Which of the following is true about epigenetic modifications?
-Epigenetic modifications always repress transcription
-Epigenetic modifications are irreversible
-Epigenetic modifications only occur on the tails of histone proteins
-Epigenetic modifications influence the relationship between DNA and
histone proteins
Transmission of information that is not contained within the sequence of DNA to daughter cells at cell division is called epigenetic inheritance.
true
false
Epigenetic marks regulate gene expression.
Which epigenetic mark is NOT associated with positive gene expression?
Histone acetylation
Histone Methylation
De-methylated DNA
Methylated DNA
Chapter 16 Solutions
Biology 2e
Ch. 16 - Figure 16.5 In E. coli, the tip operon is on by...Ch. 16 - Figure 16.7 In females, one of the two X...Ch. 16 - Figure 16.13 An increase in phosphorylation levels...Ch. 16 - Control of gene expression in eukaryotic cells...Ch. 16 - Post-translational control refers to: regulation...Ch. 16 - How does the regulation of gene expression support...Ch. 16 - If glucose is absent, but so is lactose, the lac...Ch. 16 - Prokaryotic cells lack a nucleus. Therefore, the...Ch. 16 - The a/a operon is an inducible operon that...Ch. 16 - What are epigenetic modifications? the addition of...
Ch. 16 - Which of the following are true of epigenetic...Ch. 16 - The binding of _____ is required for transcription...Ch. 16 - What will result from the binding of a...Ch. 16 - A scientist compares the promoter regions of two...Ch. 16 - Which of the following are involved in post...Ch. 16 - Binding of an RNA binding protein will the...Ch. 16 - An unprocessed pre-mRNA has the following...Ch. 16 - IS. Alternative splicing has been estimated to...Ch. 16 - Post-translational modifications of proteins can...Ch. 16 - A scientist mutates elF-2 to eliminate its GTP...Ch. 16 - Cancer causing genes are called transformation...Ch. 16 - Targeted therapies are used in patients with a set...Ch. 16 - Name two differences between prokaryotic and...Ch. 16 - Describe how controlling gene expression will...Ch. 16 - Describe how transcription in prokaryotic cells...Ch. 16 - What is the difference between a repressible and...Ch. 16 - In cancer cells, alteration to epigenetic...Ch. 16 - A scientific study demonstrated that rat mothering...Ch. 16 - Some autoimmune diseases show a positive...Ch. 16 - A mutation within the promoter region can alter...Ch. 16 - What could happen if a cell had too much of an...Ch. 16 - A scientist identifies a potential transcription...Ch. 16 - Describe how RBPs can prevent miRNAs from...Ch. 16 - How can external stimuli alter...Ch. 16 - Protein modification can alter gene expression in...Ch. 16 - Alternative forms of a protein can be beneficial...Ch. 16 - Changes in epigenetic modifications alter the...Ch. 16 - A scientist discovers a virus encoding a Protein X...Ch. 16 - New drugs are being developed that decrease DNA...Ch. 16 - How can understanding the gene expression pattern...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Suppose you exert a force of 180 N tangential to a 0.280-m-radius 75.0-kg grindstone (a solid disk). (a)What to...
College Physics
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
1. ___ Mitosis 2. ___ Meiosis 3. __ Homologous chromosomes 4. __ Crossing over 5. __ Cytokinesis A. Cytoplasmic...
Microbiology with Diseases by Body System (5th Edition)
Which of the following traits would you expect to be inherited as quantitative traits? a. body weight in chicke...
Genetic Analysis: An Integrated Approach (3rd Edition)
1. Which is a function of the skeletal system? (a) support, (b) hematopoietic site, (c) storage, (d) providing ...
Anatomy & Physiology (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following types of mutations would be most likely to cause cells to undergo apoptosis (programmed cell death)? One that increases the affinity of p21 for Cdks One that decreases the affinity of Rb for the transcription factor E2F One that decreases the ability of p53 to bind to DNA One that causes p53 to be constitutively phosphorylatedarrow_forwardSince all cells contain the same number of chromosomes and the overall same/similar genome how would the genome in a nerve cell work differently than the genome of a muscle cell? In other words what epigenetic processes cause these differences between cell types at the molecular levelarrow_forwardIn your own words, explain epigenetics. What is it? What are the main epigenetic marks? What do they do in terms of gene transcription? What are the enzymes involved?arrow_forward
- What is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3arrow_forwardAlthough each cell in your body contains the same set of genes, the genes that are “turned on” differ depending on the type of cell. What signals different genes to be “turned on” or transcribed in different cells? What types of behaviours or environmental circumstances can lead to changes in an individual’s epigenome? Explain. 3. Explain how changes in your epigenome can alter the DNA of your future children before they are even born. 4.) Explain TWO implications of these findings for society. (Hint: think big! Implications for how disease is transmitted, intergenerational trauma, the cycle of poverty, etc.)arrow_forwardWhich of the following statements does not accurately complete this statement: An epigenetic trait _________. can be passed from mother cell to daughter cell by mitosis can be passed to the next generation by meiosis is a change in the DNA sequence causes changes in gene expression All are accurate Of the following, which is a good example of epigenetic changes? methylation of DNA bases addition of acetyl groups to histones CpG islands imprinting of genes All are good examples of epigenetic changesarrow_forward
- Which of the following epigenetic changes could lead to reduced transcription of a particular gene?. Please make sure to select all correct answersarrow_forwardBase on your knowledge of DNA, chromosomes and epigenetics and upon examining the picture below, name two epigenetic factors and at least one non-epigenetic factor present on this picture. [HINT: which of the factors shown on the picture do you expect to change based on the interactions with an environment and which you expect unchanged?] Methyl Group DNA Chromatin Epigenetic Factor Histone Histone Tails Chromosomearrow_forwardPossible genetic modifications that can cause epigenetic changes in gene expression include: A- all answers are correct B- histone acetylation C- chromatin remodeling D- histone variant localization  e- DNA methylationarrow_forward
- // Which CDK and cyclin does p53 ultimately target in DNA damaged conditions? O CDK1/cyclin E O CDK2/cyclin E CDK1/cyclin B CDK2/cyclin Barrow_forwardThe study of Epigenetics includes which of the following? (Choose all that apply) 1.The vertical transmission of histone modifications 2.The vertical transmission of genetic mutations 3.How Histone acetylation affects gene transcription 4.How DNA methylation impacts chromatin structure 5.How genetic mutations impact gene transcription 6.The horizontal transmission of genesarrow_forwardHeritable effects of gene expression that are not caused by a change in DNA sequence are called epigenic changes. What causes these changes?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY