Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 10RQ
If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence:
- 3'-AATGCTAC-5'
- 3'-CATCGTAA-5' c. 3'-TTACGATG-5'
d. 3’-GTAGCATT-5'
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' .
If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
4th sequence (from the left) should be = TCG right?
using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence
5’-TAT-GGC-ATG-3’?
Ile-Arg-Pro
His-Ala-Ile
Tyr-Gly-Met
Val-Arg-Tyr
Ile-Pro-Tyr
This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the strand (which one?) . Show the RNA sequence from 5’ to 3’ direction. Then translate the RNA sequence into protein sequence using the genetic code table.
5’AGGGTCCAC 3’
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
7. Both Tim and Jan (problem 6) have a widow’s peak (see Module 9.8), but Mike has a straight hairline. What ar...
Campbell Biology: Concepts & Connections (9th Edition)
In shorthorn cattle, coat color may be red, white, or roan. Roan is an intermediate phenotype expressed as a mi...
Concepts of Genetics (12th Edition)
[14.110] The following mechanism has been proposed for the gas-phase reaction of chloroform (CHCI3) and chlorin...
Chemistry: The Central Science (14th Edition)
Which of the following factors would tend to increase membrane fluidity? A. a greater proportion of unsaturated...
Campbell Biology in Focus (2nd Edition)
2 Of the uterus, small intestine, spinal cord, and heart, which is/are in the dorsal body cavity?
Anatomy & Physiology (6th Edition)
During exponential growth, a population always (A) has a constant per capita population growth rate. (B) quickl...
Campbell Biology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Glyarrow_forwardIf the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence: a. 3'-AATGCTAC-5' b. 3'-CATCGTAA-5' c. 3'-TTACGATG-5' d. 3'-GTAGCATT-5'arrow_forwardCreate the RNA strand to be synthesized from the DNA double strand below and explain this synthesis, including the functions of the molecules responsible for synthesis. 5’-ATCGCTTGTTCGGAA-3’ 3’-TAGCGAACAAGCCTT-5’arrow_forward
- Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forwardsing the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence 5’-TAT-GGC-ATG-3’? Ile-Arg-Pro His-Ala-Ile Tyr-Gly-Met Val-Arg-Tyr Ile-Pro-Tyrarrow_forwardI have a question I'm not sure about here it is...... If a short sequence of DNA is 5’-CGTAATCGGATC-3’, its complementary RNA strand is The answers given are: 5’- GCAUUAGCCUAG -3’. 5’- GAUCCGAUUACG - 3’. 5’-GATCCGATTACG - 3’. 5’-GCATTAGCCTAG - 3’.arrow_forward
- Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’ a. Write the sequence for the complementary DNA strand. b. Write the sequence of the RNA complementary to the strand shownarrow_forwardWhich primer would bind to this coding strand as a reverse primer? 5'- ATGGCCAAAT GATTCCCACG ATTTGGCCAT TGAGATCCGG - 3' O3'- ATGGCCAAAT - 5' O 5'- CCGGATCTCA - 3' O 5'- ATGCGCAGAT - 3' O3'- CCGGATCTCA - 5' Narrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.arrow_forward
- The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwardWhat is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'arrow_forwardA peptide has the sequence NH 2-phe-pro-lys-gly-phe-pro-COOH. Which of the following sequences in the coding strand of the DNA could code for this peptide? O S'ACT-TAC-CAT-AAA-CAT-TAC-UGA 5' TTT-CCC-AAA-GGG-TTT-CCC 3' UUU-CCC-AAA-GGG-UUU-CCC 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG 5' GGG-AAA-TTT-AAA-CCC-ACT-GGGarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY