Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 23CTQ
When Chargaffwas performing his experiments,
the tetranucleotide hypothesis, which stated that DNA was composed of GACT
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
When Chargaff was performing his experiments, the tetranucleotide hypothesis, which stated that DNA was composed of GACT nucleotide repeats, was the most widely accepted view of DNA’s composition. How did Chargaff disprove this hypothesis?
Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of double strand DNA if there are 45 adenines present. Show your work for credit.
How did Griffiths and Avery discover that DNA was the molecule of heredity? Would we have been able to discover the structure of DNA without this work? Why or why not? Would we have been able to understand or actually try to understand DNA replication without his work? Why or why not?
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
In what way do the membranes of a eukaryotic cell vary? A. Phospholipids are found only in certain membranes. B...
Campbell Biology in Focus (2nd Edition)
2. What are the primary functions of the skeletal system?
Human Anatomy & Physiology (2nd Edition)
A geneticist from an alien planet that prohibits genetic research brought with him to Earth two pure-breeding l...
Concepts of Genetics (12th Edition)
Some organizations are starting to envision a sustainable societyone in which each generation inherits sufficie...
Campbell Essential Biology (7th Edition)
14. An experienced goldfish breeder receives two unusual male goldfish. One is black rather than gold, and the ...
Genetic Analysis: An Integrated Approach (3rd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Erwin Chargaff conducted several studies on the base composition of DNA. The data in Table 1 shows the molar properties of bases in the nucleic acid from six different living organisms. Nucleic acid Yeast Paracentrotus lividus Herring Rat Human Species Z (i) (ii) (iii) Adenine 31.3 32.8 27.8 28.6 30.7 30.9 Table 1 Percentage (%) Thymine 32.9 32.1 27.5 28.4 31.2 29.4 Guanine 18.7 17.7 22.2 21.4 19.3 ? Cytosine 17.1 18.4 22.6 21.5 18.8 ? A+G G+C 1.79 1.85 1.23 1.33 1.62 ? What are the percentage of Guanine and Cytosine in Species Z? Which organism has the higher melting point for its DNA structure compared to Species 7.? Explain why DNA in the presence of salt will have a higher melting temperature (Tm).arrow_forwardWhile trying to determine the structure of DNA, Watson and Crick at one point proposed that like bases are bonded to like bases. For example, thymine would be bonded to thymine, cytosine would be bonded to cytosine, and so on. Explain why this proposed model would not fit based on what was discovered to be true about DNA.arrow_forwardGiven the findings of biochemist Erwin Chargaff about the composition of DNA. Answer the following questions: (1) What is your general observation on their findings? (2) Why are the proportions of the nitrogen bases of human thymus and human sperm almost the same?arrow_forward
- Chargaff determined the base composition of DNA from a variety ofdifferent sources.What information do you know based onthe question and based on your understanding of thetopic?.arrow_forwardWhy wasn’t James Watson punished by the scientific community once more was learned about how he obtained the critical data needed to come up with the structure of DNA?arrow_forwardDraw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this dinucleotide.arrow_forward
- What would be the most obvious characteristic of the base distribution of a single-stranded DNA molecule?arrow_forwardOne strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?arrow_forwardCan you please answer these questions? I don’t know the right answers.arrow_forward
- X-ray was used by Rosalind Franklin and Maurice Wilkins to study the molecular structure of DNA. Why is their finding not accepted by Watson and Crick? Explain.arrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forwardWhat is it about the structure of DNA that makes it stable (and allows it to be replicated so exactly)?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license