Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 14RQ
In which direction does
- 5'-3'
- 3'-5‘
- 5‘
- 3’
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
If the sequence of one single strand of DNA is C-A-A-G-T-A-G-G-C-T, what is the sequence of the complementary strand?
Describe the origin of each strand of the new double helices created after DNA replication.
Why is DNA replication important to the growth and development of a multicellular organism?
Place the following terms in the correct order from smallest to largest:
Nucleosome, supercoils, coils, chromosome, DNA double helix
Which of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why?
1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’
2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’
A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break.
B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break.
C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.
D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.
Show the replication strands in each of these bubbles (note they have
different DNA orientations). Label each end of each DNA strand and include arrows to
show which direction it is extending. Show the Okazaki fragments in the correct places.
3'
5'
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
3. CAUTION Why is genetic drift aptly named?
a. It causes allele frequencies to drift up or down randomly.
b. I...
Biological Science (6th Edition)
Match the following cell types with their correct definition. _________Macrophage _________NK cell _________Eos...
Human Anatomy & Physiology (2nd Edition)
15. A good scientific hypothesis is based on existing evidence and leads to testable predictions. What hypothes...
Campbell Biology: Concepts & Connections (9th Edition)
S
10. FIGURE EX6.10 shows the velocity graph of a 2.0 kg object as it moves along the x-axis. What is the net ...
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction
4. What five specific threats to biodiversity are described in this chapter? Provide an example of each.
Biology: Life on Earth (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A region of DNA has six copies of a trinucleotide repeat. During one round of replication, the template strand slips as shown in the diagram. How many repeats will the DNA have if the newly synthesized strand is used as a template in the next round of replication? 1 5'-CAG 3'-GTC GTC 4 2 GTCH 3 2 CAG CAG GTC 3 GTC 5 4 CAG-3' GTC -5' 6 Next round of DNA replicationarrow_forwardFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forwardWhat is the difference between prokaryotic and eukaryotic DNA replication? in 3-4 sentencearrow_forward
- Supercoiled DNA is more compact than relaxed DNA of the same molecular weight, which gives supercoiled DNA greater elec- trophoretic mobility. Why, then, does positively supercoiled DNA migrate more slowly than relaxed in the experiment depicted in Figurearrow_forwardDraw the steps of DNA replication. Use the following nucleotide sequence as reference: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’arrow_forwardConsider a portion of double-stranded DNA with the complementary sequence of base pairs shown. Write the sequence of nucleotides in each new segment on the daughter strands. Label the parent and daughter strands. 5' AACCTTGG 3' 3' TTGGAACC 5'arrow_forward
- How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.arrow_forwardWhy is DNA replication called semiconservative?arrow_forwardWhat are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-Tarrow_forward
- Which of the following best describes the process of DNA replication? (type 1, 2 or 3 in the blank) conservative model semi-conservative model dispersive model The model that best describes DNA replication essentially means the DNA is kept intact and a copy is made by enzymes the DNA is separated and a new daughter copy is paired to each parental strand the DNA is dispersed into small nucleotide segments and copied pieces are inserted into the gapsarrow_forwardBelow is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from numbers and end at specific points. Answer the questions relating to the locations specified by the numbers (1) Which end (5' or 3') of the molecule is here? (2) Which enzyme is probably functioning here to deal with supercoils in the DNA? (3) Which enzyme is probably functioning here to unwind the DNA?arrow_forwardWrite the complementary strand for each of the following strands of DNA. Part 1 of 4 5'-TTCGAAAA-3' 3'- -5' ☑ Part 2 of 4 5'-CATACACG-3' 3'- -5' ☑ Part 3 of 4 5'-CAGGCTAGTTC-3' 3'- -5' ☑ Part 4 of 4 5'-GATTTAAAAGG-3' 3'- -5' Хarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY