Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 26CTQ
Prokaryotes have a single circular chromosome while eukaryotes have linear chromosomes. Describe one advantage and one disadvantage to the eukaryotic genome packaging compared to the prokaryotes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends.
DNA:
5'-ATAGGGCATGT-3'
3'-TATCCCGTACA-5' <--- template strand
Group of answer choices
5'-ATAGGGCATGT-3'
3'-UAUCCCGUACA-5'
5'-AUAGGGCAUGU-3'
3'-TATCCCGTACA-5'
For bacteria living in a rapidly changing environment, would a population of bacteria capable of conjugation be more successful than one that could not undergo conjugation? Explain why. Include in your answer a description of the process of conjugation and its advantages over other mechanisms of DNA transfer between prokaryotic organisms.
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The genes dumpy (dp), clot (cl), and apterous (ap) are linked on chromosome II of Drosophila. In a series of tw...
Concepts of Genetics (12th Edition)
1. ___ Mitosis 2. ___ Meiosis 3. __ Homologous chromosomes 4. __ Crossing over 5. __ Cytokinesis A. Cytoplasmic...
Microbiology with Diseases by Body System (5th Edition)
Which type of cartilage is most plentiful in the adult body?
Anatomy & Physiology (6th Edition)
1. Why is the quantum-mechanical model of the atom important for understanding chemistry?
Chemistry: Structure and Properties (2nd Edition)
1. a. Can a vector have nonzero magnitude if a component is zero? If no, why not? If yes, give an example.
b. C...
College Physics: A Strategic Approach (3rd Edition)
What is the difference between cellular respiration and external respiration?
Human Physiology: An Integrated Approach (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to mix with genomic DNA that has been denatured by boiling, and the two molecules are allowed to hybridize. The DNA strand is presumed to be the lighter-shaded one on the top. Note that only one strand of DNA is shown. What type of RNA is this? a eukaryotic mRNA b Any type of Eukaryotic RNA c Any bacterial or Eukaryotic mRNA d Any RNA from any speciesarrow_forwardnon-coding DNAs can be put into two groups, name themarrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
- All are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling introduced by the DnaB protein (helicase). It is a topoisomerase that hydrolyzes ATP during its reaction mechanism. Its mechanism involves the breaking of a single phosphoester bond in one strand of dsDNA. It works to relieve supercoiling in DNA to overcome the torsion stress imposed upon unwinding.arrow_forwardCell biologyarrow_forwardRestriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forward
- In comparison with prokaryotes, what are some differences in the genome structure of eukaryotic cells that affect how replication takes place?arrow_forwardThe genome of D. melanogaster consists of approximately 1.7 * 108 base pairs. DNA synthesis occurs at a rate of 30 base pairs per second. In the early embryo, the entire genome is replicated in five minutes. How many bidirectional origins of synthesis are required to accomplish this feat?arrow_forwardConsidering prokaryotes, what is the enzyme that removes the RNA primer and replaces it with newly synthesized DNA?arrow_forward
- Figure 1 is a photography obtained after spreading the replicating Escherichia coli chromosome and its observation by transmission electron microscopy. An interpretation scheme of the observed structure is shown in the upper right part of the photo. Figure 1: Photography of a replicating Escherichia coli chromosome observed by transmission electron microscopy. what is occurring at the positions C indicated by black arrows? what is the name of the main actor located at positions C?arrow_forwardThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License