Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 14, Problem 34CTQ
Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does this treatment work? Explain what occurs at the molecular level.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Give an example of a mutagen that can change cytosine to uracil.Which DNA repair system(s) would be able to repair this defect?
Two possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?
Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example:
Rifamycin inhibits prokaryotic RNA polymerase
Chloramphenicol blocks the transfer of the peptide from the P to A site.
a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible.
b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction
7. Both Tim and Jan (problem 6) have a widow’s peak (see Module 9.8), but Mike has a straight hairline. What ar...
Campbell Biology: Concepts & Connections (9th Edition)
2. The three ropes in FIGURE EX6.2 are tied to a small, very light ring. Two of the ropes are anchored to wa...
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (8th Edition)
An atom with a formal charge does not necessarily have more or less electron density than the atoms in the mole...
Organic Chemistry (8th Edition)
Why is living epithelial tissue limited to a certain thickness?
Human Anatomy & Physiology (2nd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Various antimicrobial drugs to treat microbial infection have diverse mechanism of action. Consider the following antimicrobial drugs: A. Seconeolitsine, known as DNA topoisomerase I inhibitor in bacteria. (i) Explain briefly how inhibiting DNA topoisomerase I is a good mechanism of action for an antibiotic, include possible molecular machineries being targeted. (ii) What would be an appropriate response if seconeolitsine works well by stating the state of supercoiling in bacteria. (iii) To prove your answer (ii), you test the condition of bacterial DNA by running gel electrophoresis, one has been treated with seconeolitsine (+ sample) and the other one is not (- sample). Explain the position of each + sample and – sample band on the gel in reference to the point of origin (where you load your samples) or how far each DNA sample travel across agarose gel. (iv) Explain why you would expect answer (iii) for each + sample and – sample. B.…arrow_forwardCytosine can be deaminated to form Uracil What type of mutation is this classified as? Discuss what happens to the base-pairing properties from switching from C to U? When U is replicated in two rounds of synthesis, what substitution does this result in? Before Uracil alters the DNA during replication, what repair system can be used to correct this error? Describe how this type of DNA repair works?arrow_forwardDirect repair of pyrimidine dimer formation in E. Coli can be accomplished by nucleotide excision. true or false?arrow_forward
- Consider the mechanism of the enzyme RNase: What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain. What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardWhy would a mutation in a somatic cell of a multicellular organism escape detection?arrow_forward
- Breast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginine residue in the transcribed protein. How will this mutation effect this protein? a) Polarity before and after mutation: b) Size of the region before and after the mutation: c) Tertiary interaction you would expect with substrate: d) Name an amino acid that the unaffected protein's methionine could interact:arrow_forwardGenes involved in DNA to protein route are highly conserved in comparison to genes of enzymes that catalyze steps in metabolic pathways individually. What could be the reason for this?arrow_forwardIn the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?arrow_forward
- Give three reasons why liposomes/nanoparticles are attractive drug delivery system for recombinant protein preparations?arrow_forwardWhile there is a T nucleotide in one position in one of the double chains, if there is a G nucleotide opposite this nucleotide in the complementary chain; Does this pose a problem? If you think it will cause a problem, explain what kind of problem it may create. What repair systems might work to fix this problem? Briefly describe the operation of these systems.arrow_forwardIf deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur? Describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon. A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphology is strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
USMLE-Rx Antimicrobial Therapy; Author: USMLE-Rx;https://www.youtube.com/watch?v=Pka1Ynlrqtw;License: Standard Youtube License