Concept explainers
Videos
Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?
To analyze:
Whether the bacterial gene having eukaryotic promoter gets transcribed or not.
Introduction:
Eukaryotic promoters are different from prokaryotic promoters so the bacteria would not transcribe the gene.
Explanation of Solution
In case of transcription of genes, i.e. formation of RNA (mostly m-RNA) from DNA, promoters play an essential role. Promoters are the specific DNA sequences present near the starting point of transcription of a particular gene. Promoters help in the binding of RNA polymerase and transcription machinery to the specific point in the gene to initiate the process of transcription. They are mainly located upstream of a gene, towards 5’ end of the anti-sense strand. As these are specific recognition sequences, eukaryotic promoters are different from prokaryotic promoters.
Prokaryotic promoters have three essential elements:-10 elements,-35 element and UP (upstream promoter) element.
Eukaryotic promoters mainly contain a TATA box of six nucleotides (consensus sequence is 5’ TATAAA 3’) located around-30 (with reference to initiation site of transcription +1), while prokaryotic promoters have its counterpart-10 elements or Pribnow box of six nucleotides (consensus sequence is 5’ TATAAT 3’) located at-10. Both these have A-T rich elements. Prokaryotes also have one more promoter sequence of six nucleotides at-35 which is (5’ TTGACA 3’) called as-35 elements. Pribnow box or-10 element is essential in prokaryotes for the initiation of transcription and-35 element helps in increasing the transcription rate.UP element is A-T rich sequence located between-40 to-60.
Other conserved sequences in eukaryotic promoters are CAAT box (GGCCAATCT) around-80 and GC-rich boxes (GGCG), and octamer boxes (ATTTGCAT) located further upstream.Basically, eukaryotic promoters are much more complex and larger in structure than the prokaryotic promoters.Sigma factor (s factor) of prokaryotic RNA polymerase holoenzyme recognizes and binds to the promoter interaction site to initiate transcription.
So, a bacterial gene having eukaryotic promoter would not transcribe because eukaryotic promoter has different recognition sites/consensus sequences than the required prokaryotic recognition sites. RNA polymerase, transcription factors and other proteins of host bacterial chromosome would not be able to identify the eukaryotic promoter sequences and transcription of the gene would not occur.
So, the bacteria would not transcribe the gene with the eukaryotic promoter as they are different from the prokaryotic promoters.
Want to see more full solutions like this?
Chapter 15 Solutions
Biology 2e
Additional Science Textbook Solutions
Campbell Essential Biology (7th Edition)
College Physics: A Strategic Approach (3rd Edition)
Human Physiology: An Integrated Approach (8th Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
Chemistry: A Molecular Approach (4th Edition)
Biological Science (6th Edition)
- Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleusarrow_forwardHere is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 3 4 Genomic sequence (kb) (k = kilo = 1,000) %3D 5000 bases 4200 bases 3200 bases 4800 basesarrow_forwardHow to incorporate prokaryotic gene into eukaryotic cell to make an transgenic organism?In this case what promoter will be used.explain the process in detailsarrow_forward
- Which of the following statements about the attempt to express a eukaryotic gene in bacteria is TRUE? Choose an answer below: The eukaryotic promoter will function in the bacterial cells. The transcript will be capped. Expression of the gene will always yield a functional protein. The stop codon of the eukaryotic gene will function in the bacterial cells. The transcript will be spliced the same way as in eukaryotic cells.arrow_forwardYou are studying a human gene, and try to express the protein in E. coli bacterial cells. To do this, you use lab cloning techniques to create an expression vector - a circular piece of DNA (plasmid) which can replicate within E. coli, and which contains an appropriate E. coli promoter sequence before the human protein sequence. Note that the sequence used is the final mRNA protein coding sequence, with all introns removed. You can detect that some of the protein is produced, but it's a very small amount. Luckily you included a positive control, which uses the same expression vector, and find that the control E. coli protein is expressed to high levels under the same conditions. A colleague suggests that you transform your same expression vector into a 'humanized' strain of E. coli that is optimized for the expression of human recombinant proteins (this is a real thing!). You do this and see protein expression – woohoo! If the genetic code is universal, why might a human gene be poorly…arrow_forwardConsider the generalized structure of a eukaryotic gene, and the RNA it encodes. Of the options listed below, which one set of features determines the length of the primary RNA in base pairs, before any processing has occurred? The exon and intron sequences The promoter and enhancer sequences The start and stop codons for translation The transcription start and termination sequencesarrow_forward
- Sketch a figure to show how reverse transcription is catalyzed by the enzyme reverse transcriptase. Label the nucleic acids involved and produced by the process and draw arrows to indicate the direction of synthesis along the template.arrow_forwardHere is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 1 2 3 4. Genomic sequence (kb) (k = kilo = 1,000) 2200 bases 3200 bases 2000 bases 4200 basesarrow_forwardRefer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forward
- A bioengineer takes the gene from the human liver cell and insert into a bacterial chromosome. Then, bacteria transcribe this gene into mRNA and translate this mRNA into protein. This protein produced is useless and has been found to contain more amino acid than the protein made by the eukaryotic cell. Please explain the reason for that issue.arrow_forwardWhat enzyme is used to make cDNA from pre-mRNA?arrow_forwardA principle of biology is the genetic material provides ablueprint for reproduction. Explain how gene regulation is animportant mechanism for reproduction and sustaining life.arrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
