Concept explainers
Videos
Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?
To analyze:
Whether the bacterial gene having eukaryotic promoter gets transcribed or not.
Introduction:
Eukaryotic promoters are different from prokaryotic promoters so the bacteria would not transcribe the gene.
Explanation of Solution
In case of transcription of genes, i.e. formation of RNA (mostly m-RNA) from DNA, promoters play an essential role. Promoters are the specific DNA sequences present near the starting point of transcription of a particular gene. Promoters help in the binding of RNA polymerase and transcription machinery to the specific point in the gene to initiate the process of transcription. They are mainly located upstream of a gene, towards 5’ end of the anti-sense strand. As these are specific recognition sequences, eukaryotic promoters are different from prokaryotic promoters.
Prokaryotic promoters have three essential elements:-10 elements,-35 element and UP (upstream promoter) element.
Eukaryotic promoters mainly contain a TATA box of six nucleotides (consensus sequence is 5’ TATAAA 3’) located around-30 (with reference to initiation site of transcription +1), while prokaryotic promoters have its counterpart-10 elements or Pribnow box of six nucleotides (consensus sequence is 5’ TATAAT 3’) located at-10. Both these have A-T rich elements. Prokaryotes also have one more promoter sequence of six nucleotides at-35 which is (5’ TTGACA 3’) called as-35 elements. Pribnow box or-10 element is essential in prokaryotes for the initiation of transcription and-35 element helps in increasing the transcription rate.UP element is A-T rich sequence located between-40 to-60.
Other conserved sequences in eukaryotic promoters are CAAT box (GGCCAATCT) around-80 and GC-rich boxes (GGCG), and octamer boxes (ATTTGCAT) located further upstream.Basically, eukaryotic promoters are much more complex and larger in structure than the prokaryotic promoters.Sigma factor (s factor) of prokaryotic RNA polymerase holoenzyme recognizes and binds to the promoter interaction site to initiate transcription.
So, a bacterial gene having eukaryotic promoter would not transcribe because eukaryotic promoter has different recognition sites/consensus sequences than the required prokaryotic recognition sites. RNA polymerase, transcription factors and other proteins of host bacterial chromosome would not be able to identify the eukaryotic promoter sequences and transcription of the gene would not occur.
So, the bacteria would not transcribe the gene with the eukaryotic promoter as they are different from the prokaryotic promoters.
Want to see more full solutions like this?
Chapter 15 Solutions
Biology 2e
Additional Science Textbook Solutions
College Physics
Concepts of Genetics (12th Edition)
Campbell Essential Biology with Physiology (6th Edition)
Fundamentals of Anatomy & Physiology (11th Edition)
Anatomy & Physiology
- Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleusarrow_forwardHere is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 3 4 Genomic sequence (kb) (k = kilo = 1,000) %3D 5000 bases 4200 bases 3200 bases 4800 basesarrow_forwardYou are a research scientist working in genetic engineering. You create a piece of DNA that you want to express in a mouse cell, which is a eukaryote. This piece of DNA (represented by the schematic in the figure) consists of a eukaryotic promoter, a prokaryotic gene lacking introns and exons and a eukaryotic terminator sequence. Do you think that this piece of DNA would be successfully expressed if placed into a mouse cell containing all the machinery needed for gene expression? Fully motivate your answer. The AAUAAA Eukaryotic Start Coding Stop terminator promoter codon sequence codon sequencearrow_forward
- You are studying a human gene, and try to express the protein in E. coli bacterial cells. To do this, you use lab cloning techniques to create an expression vector - a circular piece of DNA (plasmid) which can replicate within E. coli, and which contains an appropriate E. coli promoter sequence before the human protein sequence. Note that the sequence used is the final mRNA protein coding sequence, with all introns removed. You can detect that some of the protein is produced, but it's a very small amount. Luckily you included a positive control, which uses the same expression vector, and find that the control E. coli protein is expressed to high levels under the same conditions. A colleague suggests that you transform your same expression vector into a 'humanized' strain of E. coli that is optimized for the expression of human recombinant proteins (this is a real thing!). You do this and see protein expression – woohoo! If the genetic code is universal, why might a human gene be poorly…arrow_forwardSketch a figure to show how reverse transcription is catalyzed by the enzyme reverse transcriptase. Label the nucleic acids involved and produced by the process and draw arrows to indicate the direction of synthesis along the template.arrow_forwardHere is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 1 2 3 4. Genomic sequence (kb) (k = kilo = 1,000) 2200 bases 3200 bases 2000 bases 4200 basesarrow_forward
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 867 nucleotides in length, and the other is 685 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 867 and 685 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 150 nucleotides.arrow_forwardA bioengineer takes the gene from the human liver cell and insert into a bacterial chromosome. Then, bacteria transcribe this gene into mRNA and translate this mRNA into protein. This protein produced is useless and has been found to contain more amino acid than the protein made by the eukaryotic cell. Please explain the reason for that issue.arrow_forward
- A principle of biology is the genetic material provides ablueprint for reproduction. Explain how gene regulation is animportant mechanism for reproduction and sustaining life.arrow_forwardThe diagram below shows a section of double-stranded DNA undergoing both transcription and replication. RNA polymerase (gray oval) is bound to the transcriptional template strand and moving from left to right (arrow). The resulting RNA transcript is also shown (dotted line) with limited base pairing to the template strand. The DNA sequence is specified for a portion of the double-stranded DNA.arrow_forwardYou sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that?arrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
