Biology 2e
Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 15, Problem 21CTQ

A scientist sequencing itiRNA identifies the following strand:

CUAUGUGUCGUAACAGCCGAUGACCCG

What is the sequence of the amino acid chain this itiRNA makes when it is translated?

Blurred answer
Students have asked these similar questions
The following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated? The genetic code has been provided for you below. Second letter U C A G UAU UACJ UAA Stop UGA Stop A UAG Stop UGG Trp UCU ) UUU) Phe UUC J UGU U UCC UGC, U UUA LE Ser UCA -Leu UUG, UCG CAU САС His CAA CAG Gln CUU CCU CGU CGC Arg CỤC ССС Leu -Pro CỦA ССА CGA CUG СCG CGG AAC FAS AAGLYS AUU ACU AAU AGU Asn Ser AUC ile AUA AUG Met| ACG AGC AGA Arg AGG J АСС - Thr АСА AAA GAU Asp GACJ Ala GAA GUU GCU GGU U GUC Val GUA GGC Gly GGA GCC GCA GAG Glu GGG GUG GCG First letter Third letter
Given the DNA sequence below:        5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’  Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)

Chapter 15 Solutions

Biology 2e

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY