Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 27CTQ
Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Transcribe and translate the following DNA sequence of the coding strand:
5'-ATGGCCCGGTTATAAGCA-3'
This is part of the Escherichia coli DNA sequence that contains an inverted repeat.
(Note: top strand is the coding strand).
5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3'
3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5'
(i)
Draw the structure of hairpin loop that will be formed during the end of transcription.
(ii) Describe the function of the hairpin loop during transcription.
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Since astronauts in orbit are apparently weightless, a clever method of measuring their masses is needed to mon...
College Physics
Fibrous connective tissue consists of ground substance and fibers that provide strength, support, and flexibili...
Human Biology: Concepts and Current Issues (8th Edition)
What are four functions of connective tissue?
Anatomy & Physiology (6th Edition)
The accompanying chromosome diagram represents a eukaryotic chromosome prepared with Giemsa stain. Indicate the...
Genetic Analysis: An Integrated Approach (2nd Edition)
21-Year-Old Female with Skeletal Injuries
While riding her bike to campus, 21-year-old Liliana Rose was struck...
Human Anatomy & Physiology (11th Edition)
If an egg rolls out of the nest, a mother greylag goose will retrieve it by nudging it with her beak and head. ...
Campbell Biology (10th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post herearrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.arrow_forwardGiven the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.arrow_forward
- Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’arrow_forwardDesign primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length. Indicate the 5' and 3' ends of the primers. 5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'arrow_forwardThe following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGarrow_forward
- On paper, replicate the following segment of DNA: (UPLOAD PHOTO OF YOUR ANSWER) 5' ATCGGCTACGITCAC 3' 3'TAGCCGATGCAA GTG 5'arrow_forwardA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forwardExamine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.arrow_forward
- Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'arrow_forwardEcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3arrow_forwardFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY