Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 6RQ
Which event contradicts the central dogma of molecular biology?
- Poly-A polymerase enzymes process mRNA in the nucleus
- Endonuclease enzymes splice out and repair damaged DNA
- Scientists use reverse transcriptase enzymes to make DNA from RNA
- Codons specifying amino acids are degenerate and universal.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.
Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.
DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G
mRNA:
Codon:
Anticodon:
Amino Acids:
Which of the following statements are true?
Each stop codon also codes for an amino acid
Each codon in mRNA codes for exactly one amino acid
The start codon also codes for an amino acid
Each TRNA will base pair with only one codon
There are multiple codons possible for nearly all amino acids
Each TRNA carries exactly one type of amino acid
Each anticodon in tRNA pairs with exactly one codon
Each codon in TRNA codes for exactly one amino acid
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
List four different forms or types of energy. Give one example of a conversion from each of these forms to anot...
College Physics
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (6th Edition)
21-Year-Old Female with Skeletal Injuries
While riding her bike to campus, 21-year-old Liliana Rose was struck...
Human Anatomy & Physiology (11th Edition)
In Drosophila, a heterozygous female for the X-linked recessive traits a, b, and c was crossed to a male that p...
Concepts of Genetics (12th Edition)
Body, Heal Thyself The precision of mitotic cell division is essential for repairing damaged tissues like those...
Biology: Life on Earth with Physiology (11th Edition)
1. Which trophic level(s) must be present to sustain any ecosystem?
a. producers only
b. producers and consume...
Biology: Life on Earth (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below is a list of functions related to protein synthesis. Place the number for the function in the blank above its corresponding structure. 1. Copies the genetic code from DNA and carries it to the ribosomes 2. Splits DNA into two strands and transcribes MRNA from the antisense strand 3. Carries amino acids to the ribosome 4. Area on DNA antisense strand that RNA polymerase binds to begin transcription Promoter MRNA RNA TRNA region polymerasearrow_forwardBriefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAarrow_forwardEukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.arrow_forward
- In cells, proteins are synthesized from a gene sequence via the process of transcription and translation. Which of the following complementary base pairings would you observe during the synthesis (the making) of a prokaryotic protein? [I am looking for the complementary base pairing(s) you would see as you go from a gene to a protein. Note that it is prokarryotic protein and not eukaryotic protein]. DNA with mRNA mRNA with tRNA mRNA with rRNA rRNA with tRNA A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correctarrow_forwardIn your own wordsarrow_forwardExperiments have demonstrated that the "words" of the genetic code (the units that specify amino acids) are Question 43 options: three-nucleotide sequences (= triplets) two-nucleotide sequences (= duplets) single nucleotides nucleotide sequences of various lengths 3-carbon sugar moleculesarrow_forward
- Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 5' 3' ATACTTTCA transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer: Checkarrow_forwardThe genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino acid uses combinations of 3 RNA bases as letters, each triplet can specify more than one amino acid uses combinations of 3 DNA bases as letters to specify the amino acids uses combinations of 3 tRNA bases as letters to specify the amino acidsarrow_forwardHydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forward
- The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the + Jend.arrow_forwardBelow is a list of functions related to protein synthesis. Place the number for the function in the blank above its corresponding structure. 1. Copies the genetic code from DNA and carries it to the ribosomes 2. Splits DNA into two strands and transcribes mRNA from the antisense strand 3. Carries amino acids to the ribosome 4. Area on DNA antisense strand that RNA polymerase binds to begin transcription Answer Answer Answer Answer Promoter region mRNA RNA polymerase tRNAarrow_forwardWhich of the following does NOT describe DNA as it occurs in Eukaryotic cells. CHOOSE ALL THAT APPLY: 1. nitrogenous bases of opposite strands are paired through covalent bonds 2. base pairs are stacked 3.4 A (0.34 nm) apart 3. the two strands of one double helix are complementary 4. two long polynucleotide chains 5. there are 20 base pairs per each turn of a double helix 6. adenine pairs with thymine of the neighboring nucleotide in a single DNA strand 7. bases face outside of the double helix 8. consecutive nucleotides of a single DNA strand are linked by hydrogen bonds 9. here are A-T and G-C pairs in DNA double helix 10. sugar-phosphate backbone of a single DNA strand is formed by linking deoxyribose units and phosphate groups through phosphodiester bonds 11. the two strands of one helix are antiparallel 12.double helix 13. the larger major groove alternates with the smaller minor groove along the length of the double stranded DNA I tried 2,3,4,9,10,11,12,13 together and got it…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license