Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 15RQ
A scientist identifies a pre-mRNA with the following structure.
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail?
- 220bp
- 295bp
- 140bp
- 435bp
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Assume the following portion of an mRNA. Find a start signal, and
write the amino acid sequence that is coded for.
5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference.
5' AGUCCGUAC 3'
5' AAUUGCUUC 3'
An mRNA has the following sequence:
5′–AUG UAC UAU GGG GCG UAA–3′
Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminus and carboxyl-terminus.
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
A seagull flies at a velocity of 9.00 m/s straight into the wind. (a) If it takes the bird 20.0 min to travel 6...
College Physics
If an egg rolls out of the nest, a mother greylag goose will retrieve it by nudging it with her beak and head. ...
Campbell Biology (11th Edition)
CONCEPT QUESTION Review the Chapter Concepts list on p. 62. These all relate to exceptions to the inheritance p...
Concepts of Genetics (11th Edition)
Why is an endospore called a resting structure? Of what advantage is an endospore to a bacterial cell?
Microbiology: An Introduction
7. Which bones form via intramembranous ossification?
a. Irregular bones
b. Certain flat bones
c. Long bones
d....
Human Anatomy & Physiology
Name the components (including muscles) of the thoracic cage. List the contents of the thorax.
Human Physiology: An Integrated Approach (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forwardGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardGiven the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forward
- An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bparrow_forwardWhich of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the precedingarrow_forwardPolycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key differences in mRNA structure and subsequent translation that support this observation. Answer in 250 words and cover all parts.arrow_forward
- A mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.arrow_forwardAn mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminal and carboxyl-terminal ends.arrow_forwardConsider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part: 0 / 5 Part 1 of 5 What amino acid sequence is coded for by this mRNA? ☑arrow_forward
- A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon sequences formed from this mRNA during the translation process?arrow_forwardAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’arrow_forwardTranslation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning 
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY