Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 9RQ
Three different bacteria species have the following consensus sequences upstream of a conserved gene.
| Species A | Species B | Species C | |
| -10 | TAATAAT | TTTAAT | TATATT |
| -35 | TTGACA | TTGGCC | TTGAAA |
Table 15.2
Order the bacteria from most to least efficient initiation of gene transcription.
- A > B > C
- B > C > A
- C > B > A
- A > C > B
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
iii and iv
The following DNA strand is a template strand (also called non-coding strand) of an E. coli gene. Arrow indicates the direction of transcription. The asterisk indicates t
transcription initiation site
GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA
5' GCAGTGA 3'
-10
Which of the following sequences accurately represents the RNA derived from this gene?
C5' UCCUUAC 3'
C3' UCCUUAC 5'
C5' CGUCACU 3'
+10
3' AGGAATG 5'
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
List all the different gametes that are possible from the following genotypes. a. AABbCcDd b. AabbCcDD c. AaBbC...
Genetic Analysis: An Integrated Approach (3rd Edition)
Some organizations are starting to envision a sustainable societyone in which each generation inherits sufficie...
Campbell Essential Biology (7th Edition)
5. When the phenotype of heterozygotes is intermediate between the phenotypes of the two homozygotes, this patt...
Biology: Life on Earth (11th Edition)
87. Fill in the blanks.
a.
b.
c.
Introductory Chemistry (6th Edition)
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (8th Edition)
17. Anthropologists are interested in locating areas in Africa where fossils 4-8 million years old might be fou...
Campbell Biology: Concepts & Connections (9th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at Transcription Start Site (TSS) and terminates at the Terminator site. TSS 5'TATTATTAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGRAAGGCTCCTTTTGGAGCCTTTTTT-3' 3' ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter Terminator Figure 2 Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop that will be formed during transcription. Illustrate how the hairpin loop structure initiates the termination of transcription.arrow_forwardBelow is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? Wy O a. this represented the first example in eukaryotes in which translation was visualized with the electron microscope O b. each "Christmas tree" represents the transcription of a single type of rRNA (i.e. 28S or 18S or 5.8S) O c. as drawn, transcription is proceeding from left to right Od.three nucleolar organizer regions are shown 1arrow_forwardThe following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold)arrow_forward
- The following sequence is from a region of the M13 bacteriophage genome. Identify and label the promoter elements that would be recognized by the bacterial RNA polymerase. Where would transcription begin? CAGGCGATGATCAAATCTCCGTTGTACTTTGTTTCGCGCGTTGGTATAATCGCTGGGGTCAAGATGAGTarrow_forwardBelow is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'arrow_forwardb) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at Transcription Start Site (TSS) and terminates at the Terminator site. TSS 5'TATTATTAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGAAGGCTCCTTTTGGAGCCTTTTI 3' ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTCCGAGGAAAACCTCGGAAAAA-5 Promoter Terminator Figure 2 (i) Which strand of DNA (the top or the bottom) is used by RNA polymerase as a template? (ii) What are the amino acids translated from the resulting mRNA? Indicate the amino (NH3') and carboxyl (COO"') termini of the protein.arrow_forward
- Write out the sequences of the two conserved elements in the following bacterial promoter. The startpoint of transcription is shown in red. TGCTTGACTCTGTAGCGGGAAGGCGTATTATGCACACCGCGarrow_forwardWhich of the following is characteristic of genes and gene regulation in both bacteria and eukaryotes? (a) promoters (b) non-coding DNA within coding sequences (c) enhancers (d) operons (e) DNA located in a nucleusarrow_forwardThe DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.arrow_forward
- The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ In the DNA sequence, draw boxes around two exons in the gene. The splicing machinery does NOT pay attention to codons. The splicing of this DNA demonstrates that. How?arrow_forwardThe DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________arrow_forwardA given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG CCCTATCAC GATACGCAGG ATAGCAGCA 3" a) Mark the promoter in blue and transcribe from the G after the promoter. b) Translate the mRNA made c) The mRNA made by the cell was 10 nucleotides shorter than what you have made. What could have happened? d) EXTRA practice: A particular triplet of bases in the coding strand of DNA is 5'GAC 3'. What is the amino acid for this codon and will be the anticodon on the tRNA that binds the mRNA codon?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license