Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 8RQ
The -10 and -35 regions of prokaryotic promoters are called consensus sequences because.__________
- they are identical in all bacterial species
- they are similar in all bacterial species
- they exist in all organisms
- they have the same function in all organisms
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
All of the following are needed for capping of eukaryotic mRNA, EXCEPT
Question 27 options:
Guanylytransferase
S-AdoMet
RNA 5'-triphosphatase
Adenosyl-transferase
Methyl-transferase
Polypeptides can be reversed back to RNA because of the enzyme transcriptase.
The genetic material must be replicated with high fidelity and great speed.
Eukaryotic mRNA is said to be polycistronic since they encode multiple polypeptide chains
RNA-synthesis occurs inside the nucleus while protein synthesis in the cytoplasm of eukaryotic organisms.
Write T if the statement is true and write F if the statement is false
A eukaryotic gene typically has all of the following features except
O A5' UTR
An operator
A promoter
Transcription factor binding sites
Introns
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
In shorthorn cattle, coat color may be red, white, or roan. Roan is an intermediate phenotype expressed as a mi...
Concepts of Genetics (12th Edition)
In what way do the membranes of a eukaryotic cell vary? A. Phospholipids are found only in certain membranes. B...
Campbell Biology in Focus (2nd Edition)
What are the two types of bone marrow, and what are their functions?
Human Anatomy & Physiology (2nd Edition)
5. When the phenotype of heterozygotes is intermediate between the phenotypes of the two homozygotes, this patt...
Biology: Life on Earth (11th Edition)
2. Whether an allele is dominant or recessive depends on
a. how common the allele is, relative to other alleles...
Campbell Biology: Concepts & Connections (9th Edition)
19. A car starts from rest at a stop sign. It accelerates at 4.0 m/s2 for 6.0 s, coasts for 2.0s, and then slow...
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- All of the following are involved in initiation of protein translation in prokaryotes, EXCEPT Question 41 options: IF1 GTP IF3 Rho factor IF2arrow_forward_____ Mutants Are Useful in ______ the Order in Which Proteins Function.arrow_forwardEIF stands for eukaryotic initiation factors and they are part of the pre-initiation complex needed to bind with the ribosome. true or falsearrow_forward
- Please do not copy paste from web I will report if you do it.arrow_forwardThis question refers to the mRNA sequence below: 5-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3" As this mRNA is translated, the fifth codon is Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.arrow_forwardplease answer the question as fast as possible i would really appritiate itarrow_forward
- The following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNAarrow_forwardDo question 39arrow_forwardE. coli Expression Systems Can Produce Large Quantities of Proteins from _____ ________.arrow_forward
- The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that we used last week. The mutations can be seen underlined in purple (You can use your mature RNA to skip some steps, just make sure to change the nucleotides that are marked below. With this information please answer the questions below. What is the sequence of the polypeptide that will be generated from the mature mRNA? write a "-" between each amino acid. All in caps. Write STOP for the stop codon. Example ALA-LEU-MET-ILE...arrow_forwardThis question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.arrow_forwardThe fact that some eukaryotic rRNAs are self-splicing indicates that RNA structures are highly variable. They can function as ribozyme. Eukaryotes have multiple RNA polymerases. RNA can contain modified bases.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license