Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 11RQ
What transcripts will be most affected by low levels of a-amanitin?
- 18S and 28S rRNAs
- pre-m RNAs
- 5S rRNAs and tRNAs
- other small nuclear RNAs
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
None
Which of the following is false?
Options:
tRNAs are heavily processed but in a manner that is different than mRNAs
mRNAs are protected from degradation by modifications at the 5' and 3' end
rRNAs are all cleaved from a larger pre-rRNA precursor
Group II splicing requires protein and RNA to excise intron sequences
methylation of histone 3 at K4 results is mostly associated with activated transcription
What type of RNA corresponds to the statement?
Prokaryotic
Eukaryotic
MRNA
TRNA
hnRNA
snRNA
FRNA
rRNA
rRNA
combined
with 33
proteins
product of
post-
transcription
process
саpped to
avoid
deterioration
carrier of
anticodon
conversion of
hnRNA
initial product
of
transcription
carrier of the
amino acids
target of
antibiotic
drugs
carrier of
codon
four types of
FRNA
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
A runaway train car that has a mass of 15,000 kg travels at a speed of 5.4 m/s down a track. Compute the time r...
College Physics
16. Explain some of the reasons why the human species has been able to expand in number and distribution to a g...
Campbell Biology: Concepts & Connections (8th Edition)
2. Whether an allele is dominant or recessive depends on
a. how common the allele is, relative to other alleles...
Campbell Biology: Concepts & Connections (9th Edition)
Although many chimpanzees live in environments with oil palm nuts, members of only a few populations use stones...
Campbell Biology (11th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (6th Edition) - standalone book
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycinearrow_forwardEukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.arrow_forwardIn Figure 10-4, why is cDNA made only from mRNAand not also from tRNAs and ribosomal RNAsarrow_forward
- Which modification of eukaryotic mRNA is likely absent if the mRNA can leave the nucleus but cannot bind the ribosome? Group of answer choices splicing together of exons removal of introns 3′ polyadenylated tail 7-methylguanosine cap on the 5′ end RNA editingarrow_forwardThe processing of ribosomal RNA in eukaryotes is shown . Why is this called cleavage or processing but not splicing?arrow_forwardLabel if each 0f the fonouing Sequences are present in DNA, pre-RNA andlor MRNA of eukanyotes : Promoter Enhancer 3'UTR Introns - Poly-A - Tail- 5 Cun sensus spiice Site- Start Codon - Cleavage signal sequence –arrow_forward
- What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerasearrow_forwardWhat are functions of the M7G cap? Select all the apply. O Slows degradation from the 5' end of the mRNA O Slows degradation from the 3' end of the mRNA O helps start translation by recruiting the mRNA to the small ribosomal subunit O is the first nucleotide to be transcribedarrow_forwardWhich subunit of RNA Pol I| functions as an assembly platform and regulator of pre- MRNA processing? Carboxyl terminal domain N-terminal domain minor O All of the abovearrow_forward
- How can one primary transcript result in several polypeptides with different amino acid sequences? alternative splicing of exons O phosphorylation of proteins after translation incorporation of an amino acid at a stop codon addition of a polyA tail to the mRNAarrow_forwardWhich mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5'-GGCCCUUUUACCCGGUUUU-3' 5'-GCAUCUUACUGAUGCUUUU-3' a stem-loop hairpin structure followed by a sequence of uracil residues in the RNA a palindromic region followed by a sequence of adenine residues in the RNA a sequence of uracil-adenine RNA-DNA base pairsarrow_forwardw/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning 
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY