Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 19, Problem 17CTQ
Explain the
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 19 Solutions
Biology 2e
Ch. 19 - Figure 19.2 In plants, violet flower color (V) is...Ch. 19 - Figure 19.4 Do you think genetic drift would...Ch. 19 - Figure 19.8 In recent years, factories have become...Ch. 19 - What is the difference between micro- and...Ch. 19 - Population genetics is the study of: how selective...Ch. 19 - Which of the following populations is not in...Ch. 19 - One of the original Amish colonies rose from a...Ch. 19 - When male lions reach sexual maturity, they leave...Ch. 19 - Which of the following evolutionary forces can...Ch. 19 - What is assortative mating? when individuals mate...
Ch. 19 - When closely related individuals mate with each...Ch. 19 - What is a cline? the slope of a mountain where a...Ch. 19 - Which type of selection results in greater genetic...Ch. 19 - When males and females of a population look or act...Ch. 19 - The good genes hypothesis is a theory that...Ch. 19 - Solve for the genetic structure of a population...Ch. 19 - Explain the Hardy-Weinberg principle of...Ch. 19 - Imagine you are trying to test whether a...Ch. 19 - Describe a situation in which a population would...Ch. 19 - Describe natural selection and give an example of...Ch. 19 - Explain what a cline is and provide examples.Ch. 19 - Give an example of a trait that may have evolved...Ch. 19 - List the ways in which evolution can affect...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Mendel crossed peas having round green seeds with peas having wrinkled yellow seeds. All F1 plants had seeds th...
Concepts of Genetics (12th Edition)
1. An object is subject to two forces that do not point in opposite directions. Is it possible to choose their ...
College Physics: A Strategic Approach (3rd Edition)
10. The dorsal pigment pattern of frogs can be either “leopard” (white pigment between dark spots) or “mottled”...
Genetic Analysis: An Integrated Approach (3rd Edition)
Match the following cell types with their correct definition. _________Macrophage _________NK cell _________Eos...
Human Anatomy & Physiology (2nd Edition)
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction
Distinguish between microevolution, speciation, and macroevolution.
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
What is Evolution?; Author: Stated Clearly;https://www.youtube.com/watch?v=GhHOjC4oxh8;License: Standard Youtube License