Answered: Say you get…

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1SQ

See similar textbooks

Related questions

Q: Please help me to draw this by hand. In as much detail as possible, hand draw a schematic diagram of…

A: Feedback loops control how much of each hormone is produced by sending signals back to the brain.…

Q: Answer in step by step with explanation. Don't use Ai and chatgpt.

A: Step 1: Multimodal Association Cortex (A)Function: - Multiple sensory modalities (such as vision,…

Q: 1. What is the effect of a 5% chance of miscommunication (error) on the evolutionof cooperation:a)…

A: Key references: Van Dijk, E., Wilke, H. A. M., & Giebels, E. (2008). The effects of uncertainty…

Q: The structure (a specialized synapse) that allows neurons to control our skeletalmusclefibers is…

A: The question is asking for the name of the structure that allows neurons to control our skeletal…

Q: What kind of organ size regulation is occurring when you graft multiple organs into a mouse and the…

A: Organ Size Regulation in Grafted Organs: Systemic Growth Control MechanismsIntroductionOrgan size…

Q: QUESTION 8 Coating a bacteria with antibodies or complement is called... Ingestion Opsonization O…

A: In the immune response, there are several processes that occur to help the body fight off pathogens…

Q: A 10 mg/Kg dose of a drug is given by intravenous injection to a 20 Kg dog. What is the volume of…

A: Vd= Dose/Plasma ConcentrationGiven:Dose = 10 mg/kg×20 kg=200 mg Plasma Concentration = 0.1…

Q: 3. Complete the reaction by drawing an arrow-pushing mechanism. Draw the product in the provided…

A: Approach to solving the question: E1cB reaction :As we know, E1cB reaction is an elimination…

Q: 18. Watch this short youtube video about SARS CoV-2 replication. SARS-CoV-2 Life Cycle (Summer 2020)…

A: 21. What is the role of the golgi apparatus related to SARS CoV-2 Role of the Golgi Apparatus…

Q: What Genus is this?

A: This image shows a microscopic green alga that belongs to the genus Scenedesmus, a common genus of…

Q: True or False? a.____If a restriction enzyme recognizes the restriction site, 5’AACGTT3’, and the…

A: 1. Restriction Enzyme Recognition and Sticky EndsRestriction enzymes, also known as restriction…

Q: Select a diet and give a summary of the main components. Do a web search of the diet and choose one…

A: For this analysis, let's select the Ketogenic Diet which is a popular diet plan.

Q: I'm struggling with this topic and would really appreciate your help. I need to hand-draw a diagram…

A: 2.3. Examples: Key references:

Q: Designing The Experiment In this Lab you will be controlling the mutations and environment of a…

A: First, we need to identify the rabbit phenotype that we want to study. A phenotype is a visible…

Q: List substitutions in your diet you could make to improve it based on what you know now about a…

A: References:https://www.healthline.com/nutrition/too-much-sugarhttps://www.medicalnewstoday.com/artic…

Q: The arrows in the diagram below show how energy and matter flow between organisms. M

A: The diagram shows the flow of energy and matter between producers and consumers in an…

Q: Bacterial species Cell wall type Example: S. mitis Gram positive S. epidermidis H. pylori M. bovis…

A: Example drawing of each bacteria:Detailed explanation: Staphylococcus epidermidisCell Wall…

Q: What are coupled transporters?

A: Coupled transporters are integral membrane proteins that facilitate the simultaneous movement of two…

Q: when we collect fish or mussels we record a variety of biological information, including but not…

A: When we collect biological information from organisms like fish or mussels, we are essentially…

Q: four physial characteristics of a fish or a mussel that would help you identify it to a species

A: When identifying a fish species, there are several physical characteristics to consider:Body Shape:…

Q: t numbers of endangered Species in California's 4. The data in the table below show the percent…

A: Instead of different colors, you can draw different patterns in bar to distinguish between them, if…

Q: After oral administration of 10mg of a drug, 50% is absorbed and 40% of the amount absorbed is…

A: 1. Calculate the amount of drug absorbed:Absorbed amount = Total dose * Absorption…

Q: 1. In vivo testing provides valuable insight into a drug’s kinetics. Assessing drug kinetics…

A: These pharmacokinetic issues are resolved by applying equations derived from concentration-time…

Q: A sample of blood was taken from the above individual and prepared for haemoglobin analysis.…

A: Cell lysis is the process where the cell membrane is disrupted, leading to the release of cellular…

Q: In individuals with cardiovascular disease, what is the cause of angina pectoris/chest pain? A)…

A: Angina pectoris, commonly referred to as chest pain, is a symptom of cardiovascular disease,…

Q: yu yeuwyuyuierydtgcygucygzycghjcygyugfyudguygcywgduycgyudgs yg

A: Step 1: Understanding the Genetic CrossWe are given three traits in cucumbers:1. Fruit Texture:•…

Q: How does stimulating the neuron send a signal to the brain? Please answer questions 3 & 4 only.

A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology

Q: Suppose that a single competent bacterial cell is transformed by taking up some environmental DNA.…

Q: a) Polymerase Chain Reaction is a way that scientists amplify (or create billions of copies of) DNA…

A: The components required for Polymerase Chain Reaction (PCR) are: DNA polymerase: This enzyme…

Q: Which of the following structures is a part of an organelle? Crista Golgi complex ER Nucleoid Cell…

A: Crista: This is part of the mitochondria, an organelle. Cristae, which are folds in the inner…

Q: Hello, Can you please help me with an overview of Microbemia. A description of the causative agent,…

A: An Explanation of MicrobacteriaIt is a general medical term that is used to describe the presence of…

Q: Based on your results, which suspect's DNA best matches the DNA found at the crime scene?

A: This image is intended for reference only

Q: Explain why homologies are used in constructing phylogenetic trees (2 pts). Give two specific…

A: Two Specific Examples of How Using Analogous Characters Would Result in an Incorrect Phylogenetic…

Q: Please write a 500-word report about the intake of saturated fat, sodium, alcoholic beverages, or…

A: The nutrient chosen for this discussion is sodium. Sodium is an essential nutrient required for…

Q: The Latin genus for carrots is (spell precisely) What we harvest and eat is a thickened What is the…

A: 1. The Latin genus for carrots is (spell precisely)Daucus2. What we harvest and eat is a…

Q: Developmental Biology What is the definition of 1 M? (in the context of stock and dilutions)

A: 1M refers to the number of moles of solute(stock) present in one litre volume of…

Q: a) What are the phenotypic ratios of this cross? b)…

A: Detailed Explanation: Understanding the Cross The provided image showcases a cross between two fruit…

Q: Which subunit of a GPCR is most important in determining its function?

A: Once the receptor is activated, the downstream signaling pathway is determined by the alpha (α)…

Q: The ability or capacity to “store” Energy, from the Sun, is limited to a certaintype of molecule…

A: The question is asking about the type of molecules that can harness and store energy from the sun.…

Q: Green Algae, as a group, is actually paraphyletic with one subgroup more closely related to higher…

A: The question is asking us to identify which group of green algae is more closely related to higher…

Q: As often happens in science, one observation or experiment that is used to look at oneaspect or…

A: Angelina Hesse was the wife of Walther Hesse, a colleague of Robert Koch. She suggested the use of…

Q: Which of the following is not true about the life-cycle of Fucus. a. 8 eggs per oogonium…

A: Fucus is a genus of brown algae that is commonly found in the intertidal zones of rocky seashores.…

Q: What are some medical issues or health trends that may have a direct link to the idea of keeping fat…

A: Dietary fat is essential for overall health, yet many people avoid it due to misconceptions about…

Q: Name something that could be happening to glutamate transporters that could have this effect on…

A: IntroductionGlutamate is the primary excitatory neurotransmitter in the central nervous system…

Q: 9. Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule…

A: Step-by-Step Calculation of ATP Yield from One Lipid MoleculeThe given lipid consists of:One…

Q: Does the neural crest have to undergo epithelial to mesenchymal transition prior to migration…

A: Summary: EMT and Neural Crest MigrationYes, Neural crest cells must undergo…

Q: What are some external influences that keep people from making healthy eating decisions?

A: The capacity of individuals to select healthy dietary choices is heavily limited by three major…

Q: How is pulmonary fibrosis diagnosised?

A: The first step in diagnosing pulmonary fibrosis is a physical examination by a healthcare provider.…

Q: There are many differences between DNA replication happening during mitosis in a Douglas fir tree…

A: PrimersNucleotidesPolymeraseTarget sequenceNumber of copiesTreeRNA primers made by primasedNTPs (A,…

Q: Potassium deficiency can result in irregular heart rhythms including bradycardia (slow heart rate),…

A: Approach to solving the question: Detailed explanation: Examples: Key references: Fuster, V., &…

Question

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

A plasmid is a circle of ___ . a. RNA b. DNA c. either RNA or DNA d. histone proteins
n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
Cloning Genes Is a Multistep Process Which enzyme is responsible for covalently linking DNA strands together? a. DNA polymerase b. DNA ligase c. EcoRl d. restriction enzymes e. RNA polymerase
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
Match the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA ligase _____ cDNA synthesis c. reverse transcriptase _____ DNA sequencing d. restriction enzyme _____ pasting DNA e. DNA polymerase (not Taq)
Match each term with the most suitable description. ______ DNA profile a. GMO with a foreign gene ______ Ti plasmid b. alleles commonly have them ______ probes c. unique array of short tandem repeats ______ SNPs d. used to find clones. ______ transgenic e. mouse vs. human ______ genomics f. used in plant gene transfers ______ CRISPR g. based on RNA interference
Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?
What carries a gene from one organism into a bacteria cell? a. a plasmid b. an electrophoresis gel c. a restriction enzyme d. polymerase chain reaction
Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.) 5 CCGAGGAAGCTTAC 3 3 GGCTCCTTCGAATG 5