a) Polymerase Chain Reaction is a way that scientists amplify (or create billions of copies of) DNA in vitro (in a tube.) b) Compare PCR with DNA Replication in the cell. Circle the components that are required for PCR. For the parts that are not circled, list them below and write an explanation for why they are no longer needed when DNA replication of a target gene is done in vitro. DNA Gyrase (or Topoisomerase) DNA polymerase Helicase SSBPs Ligase dNTPs Primers Sliding Clamp Replisome

a) Polymerase Chain Reaction is a way that scientists amplify (or create billions of copies of) DNA in vitro (in a tube.) b) Compare PCR with DNA Replication in the cell. Circle the components that are required for PCR. For the parts that are not circled, list them below and write an explanation for why they are no longer needed when DNA replication of a target gene is done in vitro. DNA Gyrase (or Topoisomerase) DNA polymerase Helicase SSBPs Ligase dNTPs Primers Sliding Clamp Replisome

Name: a) Polymerase Chain Reaction is a way that scientists amplify (or crea
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: a) Polymerase Chain Reaction is a way that scientists amplify (or create billions of copies of) DNA in vitro (in a tube.) b) Compare PCR with DNA Replication in the cell. Circle the components that are required for PCR. For the parts that are not cir

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 10SQ

See similar textbooks

Similar questions

Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
In DNA replication, RNA primase is used to construct primers which are complementary to the DNA strand. In PCR we include primers that flanks (sits down on either side) the area of the genome we want amplified. A primer is needed in order for DNA polymerase to start the replication process (making covalent bonds between nucleotides). Specifically, why is the primer needed in order for DNA ploymerase to start synthesis? A ) primers provide the free OH group needed by DNA polymerase to make the first covalent bond B) to prevent DNA helicase from breaking too many H bonds C) the DNA is in danger of becoming denatured without a primer D) primers provide the free phosphate group needed by DNA polymerase to make the first covalent bond E) primers will provide enough energy to help the reaction occur
Explain why DNA ladders are usually included during gel electrophoresis. One aspect of PCR that can be modified is the annealing temperature. In general, higher annealing temperatures show more specificity towards a single template, whereas lower annealing temperatures show less specificity and may bind to multiple regions throughout the genome. Discuss how using an annealing temperature that is too high or too low might influence the results of a PCR assay (and gel electrophoresis results) such as the one used in this study.
Look at each PCR component listed below. For each one, determine which steps(s) of the PCR reaction (denaturation, annealing or extension) would be directly affect if that component were missing. Taq polymerase: Oligonucleotide primers: DNA template: Deoxynucleotides (A, T, G and C): Imagine that you correctly prepare your PCR reaction mixture, but there is something wrong with the thermal cycler. Describe what would happen if: The thermal cycler was stuck on 940C: The thermal cycler cycled between 600C and 720C, but never reached 940C The thermal cycler cycled between 940C and 720C, but never reached 600
The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the quantity of DNA is very small, mixed, or contaminated with other organisms. Explain (with words) the how PCR works using a diagram to help illustrate this (show a minimum of three cycles to illustrate your point).
Put the steps of one PCR cycle in the correct order: The PCR reaction mixture is heated to about 70 degrees, which is the optimum temperature for the polymerase to build the new strands of DNA, starting at the 3' end of the primer. The PCR reaction mixture is heated to 95 degrees Celsius, which denatures the double stranded template DNA. The PCR reaction mixture is cooled to about 50-55 degrees, which allows the primers to find their complementary site on the template and "anneal" the
For what purposes is DNA extraction done? (give at least 3 purposes for which you may need to extract DNA)
Restriction endonuclease and ligase are two types of enzymes used in the process of genetic engineering, i.e., the manipulation of genes. The restriction endonuclease differs from ligase in that it breaks the DNA at ends, while ligase causes the breaks in DNA from interior joins the fragments of DNA, while ligase breaks the DNA into fragments breaks the DNA at specific points, while the ligase joins the fragments of DNA breaks the DNA apart at each nucleotide, while ligase use the pieces to translate
How many PCR cycles are required to generate double-stranded target fragments?
Polymerase chain reaction (PCR) is a technique that enables multiplication of specific DNA sample at minute amount to millions or billions of copies at a short time span. (i) (ii) Figure 1 indicates the chemicals added into the PCR reaction tube prior to the addition of thermostable DNA polymerase. Do you agree with the list? Justify your answer. DNA template Buffer (containing Tris-HCI, KCI, Mg2+) ddNTP Forward primer Reverse primer Figure 1 If TA cloning is planned to be carried out after amplification of the gene, which thermostable DNA polymerase will you select and the reason for your selection?
Most PCR reactions do not use the more expensive types of DNA polymerase, which have DNA proofreading. How might this be a problem in accurately copying specific DNA sequences of the target gene?
There are many PCR techniques available to suit the needs of all researchers in their laboratory task. (i) (ii) What is the major difference in the functions performed by the conventional PCR and real time PCR? Shania is planning to study the gene expression of Escherichia coli after a drug- treatment. She needs to decide between two types of chemistries to detect her PCR products (TaqMan Chemistry vs. SYBR Chemistry) using real-time PCR instruments. Compare and contrast between TaqMan Chemistry and SYBR Chemistry.