Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 7QP
Cloning Genes Is a Multistep Process
The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.)
5′ CCGAGGAAGCTTAC 3′
3′ GGCTCCTTCGAATG 5′
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
You are studying a protein that contains the peptide sequence
RDGSWKLVI. The part of the DNA encoding this peptide is included
in the sequence shown below.
5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3'
3'-GCACTGCCGAGCACCTTCGATCAGTAG-5'
This sequence does not contain any BamHI restriction enzyme sites.
The target sequence for the BamHI restriction nuclease is GGATCC.
Your goal is to create a BamHI site on this plasmid by manipulating the
DNA sequence, without changing the coding sequence of the protein. How
would you do this, ie what would the new sequence be?
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
Given the following double-stranded fragment of DNA:
5'- ACTTGGCAGGCCTTCGATCC-3'
3'- TGAАССGTCСGGAAGCTAGG-5'
A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold
symmetry (typical for restriction enzymes) found in this fragment and catalyzes
cleavage of this DNA on both strands between GG nucleotides within the recognition
sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes).
Draw the double-stranded sequence of each fragment after cleavage showing any
phosphates left on the ends.
Chapter 13 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 13.5 - Do you think the way this issue was handled should...Ch. 13.5 - Prob. 2EGCh. 13.7 - If you were offered the chance to have the genome...Ch. 13.7 - Prob. 2EGCh. 13 - Improving the nutritional value of food has long...Ch. 13 - Improving the nutritional value of food has long...Ch. 13 - Prob. 3CSCh. 13 - What Are Clones? Cloning is a general term used...Ch. 13 - Prob. 2QPCh. 13 - Prob. 3QP
Ch. 13 - Prob. 4QPCh. 13 - Prob. 5QPCh. 13 - Prob. 6QPCh. 13 - Cloning Genes Is a Multistep Process The following...Ch. 13 - Prob. 8QPCh. 13 - Prob. 9QPCh. 13 - Cloning Genes Is a Multistep Process Which enzyme...Ch. 13 - Cloning Genes Is a Multistep Process In cloning...Ch. 13 - Prob. 12QPCh. 13 - Prob. 13QPCh. 13 - Prob. 14QPCh. 13 - Prob. 15QPCh. 13 - Cloned Libraries You are running a PCR to generate...Ch. 13 - Prob. 17QPCh. 13 - Prob. 18QPCh. 13 - Prob. 19QPCh. 13 - Analyzing Cloned Sequences A base change (A to T)...Ch. 13 - Prob. 21QPCh. 13 - Analyzing Cloned Sequences What kind of...Ch. 13 - Prob. 23QP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the segment of DNA: How many open reading frames (ORF) are in this sequence? How many amino acids are encoded in all open reading frames in this segment/sequence? Which strand is the template strand for the longest open reading frame?arrow_forwardEcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3arrow_forwardHgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence to be found in any genome, considering that there are 4 possibilities for each of the 5 nucleotides in the restriction site sequence?arrow_forward
- #16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?arrow_forwardIn a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’arrow_forwardPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAarrow_forward
- Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t copy and paste from Google thank youarrow_forwardthe one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?arrow_forwardCRISPR One of the more recent advances in biotechnology is the development of the CRISPR gene modification tool. Match the following descriptions the the key players in this technology. NOTE: If you want to change your selection, you'll need to delete the one you already chose. After you delete it, the list of choices will pop back up and you can make a different choice. CRISPR technology Specialized stretches of DNA with nucleotide repeats and Cas9 protein spacers Enzyme that cuts DNA crRNA Guides the enzyme to the target site CRISPR DNA Adapted from the natural defense mechanism of bacteria and archaeaarrow_forward
- Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheaderarrow_forwardAbout 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base pairs of DNA, about how many times will the following restriction sites be present? Q.. BamHI (recognition sequence is 5′–GGATCC–3')arrow_forwardTelomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License