Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 16QP
Cloned Libraries
You are running a PCR to generate copies of a fragment of the cystic fibrosis (CF) gene. Beginning with two copies at the start, how much of an amplification of this fragment will be present after six cycles in the PCR machine?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Make the PCR Cocktail
This table lists the ingredients, stock reagent concentrations, and concentrations in the PCR reaction.
Prepare a "PCR cocktail" to be added to your samples to achieve these concentrations. Make enough cocktail to run nine samples.
[Four student samples + three positive controls + one negative control + one extra.]
{Hint: Remember that the concentration in the reaction is not the same as the concentration in the cocktail!]
Component
Stock Concentration
Concentration in the PCR reaction
Volume per reaction
Volume to make cocktail
Sterile water
-
-
µl
µl
PCR buffer w/ MgCl2
10x
1x
µl
µl
Nucleotide mix
10 mM
0.2 mM
µl
µl
Primer 1 (Forward)
10 µM
1.0 µM
µl
µl
Primer 2 (Reverse)
10 µM
1.0 µM
µl
µl
Taq DNA polymerase
5 U/µl
1.0 U
µl
µl
DNA template (sample)
-
~1 ng
20 µl
µl
Total
-
-
40 µl
µl
In PCR amplification Why is it important to know the length of the sequence you amplify?
Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had
indeed facilitated research in various areas of molecular biology and genetics. You would like
to amplify a particular gene fragment from the yeast genome using Polymerase Chain Reaction
(PCR). What are the THREE (3) main cycles in PCR? Discuss the processes at each PCR cycle
mentioned.
Chapter 13 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 13.5 - Do you think the way this issue was handled should...Ch. 13.5 - Prob. 2EGCh. 13.7 - If you were offered the chance to have the genome...Ch. 13.7 - Prob. 2EGCh. 13 - Improving the nutritional value of food has long...Ch. 13 - Improving the nutritional value of food has long...Ch. 13 - Prob. 3CSCh. 13 - What Are Clones? Cloning is a general term used...Ch. 13 - Prob. 2QPCh. 13 - Prob. 3QP
Ch. 13 - Prob. 4QPCh. 13 - Prob. 5QPCh. 13 - Prob. 6QPCh. 13 - Cloning Genes Is a Multistep Process The following...Ch. 13 - Prob. 8QPCh. 13 - Prob. 9QPCh. 13 - Cloning Genes Is a Multistep Process Which enzyme...Ch. 13 - Cloning Genes Is a Multistep Process In cloning...Ch. 13 - Prob. 12QPCh. 13 - Prob. 13QPCh. 13 - Prob. 14QPCh. 13 - Prob. 15QPCh. 13 - Cloned Libraries You are running a PCR to generate...Ch. 13 - Prob. 17QPCh. 13 - Prob. 18QPCh. 13 - Prob. 19QPCh. 13 - Analyzing Cloned Sequences A base change (A to T)...Ch. 13 - Prob. 21QPCh. 13 - Analyzing Cloned Sequences What kind of...Ch. 13 - Prob. 23QP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Analyze the PCR products in Fig. 1A by describing your observations and the PCR result. Your analysis should be in maximum of 5 sentences in bullet form. Include the following in your analysis: Observations: Are bands present? If yes, what the approximate size in bp of each band? Results: Was amplifying the target gene successful?arrow_forwardRunning a PCR Why is a Hotstart necessary and how is it achieved? Why are the three temperatures necessary for PCR? Explain the role of each. Why does the lid of the thermocycler need to be heated? Why did we conduct an amplification reaction with no DNA? When looking at your PCR results why do you only see one band? What size were each of your PCR products?arrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forward
- PCR errors during library amplification are one possible source of false positive results. If an error occurs in the first round of amplification, all the subsequent copies of that library fragment will also carry the variant, even though it is not present in the genome. However, reads from other library fragments spanning this same region will not have the variant, which means that identifying PCR copies, or clones, of library fragments during analysis can help to identify these types of errors. Based on what you know about PCR, which of the following statements would be true about the PCR clones in a sequencing library? A. PCR is subject to amplification bias, so reads derived from PCR clones will only map to regions that are not GC-rich. B. PCR is subject to amplification bias, so reads derived from PCR clones will only map to non-repetitive regions. C. PCR produces identical copies, so reads derived from PCR clones would map to the exact same location. D. PCR introduces many…arrow_forwardA typical polymerase cycle reaction (PCR) program (Figure 3) followed as: HOLD 1 HOLD 3 HOLD 2 (30CYCLES) 95° C 94°C 72C 72° C 04:00 1:00 1:00 10:00 52.0° C 1:00 04° C 00 Figure 3 (i) Why is polymerase cycle reaction (PCR) repeated 30 times (Figure 3)? What are the differences between primers for PCR program, and primers for DNA replication process during S-phase? (ii) (iii) What are the FIVE (5) basic reagents used in PCR?arrow_forwardWhat is expected theoretical number of copies of DNA molecules after 28 cycles in a PCR experiment? What is the percent efficiency of the PCR experiment if the actual number of copies was 500,000,000? Show your calculationsarrow_forward
- You are working in a molecular biology laboratory and are having challenges with your PCR. You decide to double-check the PCR protocol programmed into the thermal cycler and discover that the annealing temperature was programmed to be 65 °C instead of 50 °C, as you had intended. What effects would this mistake have on the PCR reaction? Suggest potential solution(s).arrow_forwardYou want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map included). After enzyme digestion your amplicon is 854 bp long. What length will the recombinant plasmid be after you have inserted your amplicon? Show a calculation.arrow_forwardThe target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended, the resulting amplicon will be how many base pair (bp) long? 5' ACGTGCGAGCACGTATATATGTCGCGTGCTGAGTGTAGCGTATGCGAATCACCGC 3' 3' TGCACGCTCGTGCATATATACAGCGCACGACTCACATCGCATACGCTTAGTGGCG 5' 31bp 39bp 42bp 47bp None of the abovearrow_forward
- Clone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*arrow_forwardGive typed full explanationarrow_forwardTranscriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License