Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 18, Problem 1ITD
You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies of a short, tandemly repeated DNA sequence. PCR is used to determine the number of alleles present, as shown by the size of the DNA fragment amplified. In the Figure below are the results of PCR analysis for STR alleles at a locus where the repeat unit length is 9 bp, and alleles are known that have 5 to 11 copies of the repeat. Given the STR alleles present in the adults, state whether each of the four juveniles could or could not be an off-spring of those two adults. Explain your answers.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?
For the STR site diagramed below, each repeat unit, represented by a rectangle, is known to be 5 bp long. The total length of
the amplified PCR product for the chromosome shown below is 420 bp long.
PCR product - 420 bo
Primer
Left
STR STR STR STR
Primer
Right
What size would the PCR product be for a different chromosome where there were only two tandem repeat units, instead of
four? SHOW YOUR WORK.
A gel pattern displaying PCR products shows four strong bands. The four pieces of DNA have lengths that are approximately in the ratio of 1 : 2 : 3 : 4. The largest band is cut out of the gel, and PCR is repeated with the same primers. Again, a ladder of four bands is evident in the gel. What does this result reveal about the structure of the encoded protein?
Chapter 18 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 18.1 - What features do restriction enzymes have in...Ch. 18.1 - Prob. 2SBCh. 18.1 - What information and materials are needed to...Ch. 18.2 - What is a transgenic organism?Ch. 18.2 - Prob. 2SBCh. 18.3 - What is a restriction fragment length polymorphism...Ch. 18.3 - Prob. 2SBCh. 18.3 - Prob. 3SBCh. 18 - Prob. 1TYKCh. 18 - Prob. 2TYK
Ch. 18 - Why are antibiotic resistance markers such as ampR...Ch. 18 - After a polymerase chain reaction (PCR), agarose...Ch. 18 - A cDNA and a cloned fragment of genomic DNA share...Ch. 18 - Prob. 6TYKCh. 18 - Which of the following is not true of somatic cell...Ch. 18 - Prob. 8TYKCh. 18 - Prob. 9TYKCh. 18 - Prob. 10TYKCh. 18 - Prob. 11TYKCh. 18 - Discuss Concepts A forensic scientist obtained a...Ch. 18 - 13. Suppose a biotechnology company has developed...Ch. 18 - Prob. 14TYKCh. 18 - You learned in the chapter that an STR locus is a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on gel electrophoresis, specific sequences can be amplified by PCR. For a sequence of a 100 base pairs, calculate the number cycles of PCR required to generate 1 ng of DNA, when starting from a single copy. Note that the molar mass of an average DNA bp is 600 g/mol.arrow_forwardDescribe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.arrow_forwardSelect all that would be true if I had a nonsense mutation in an exon of a gene: The nonsense mutant allele would be the same size as wildtype by PCR-electrophoresis The nonsense mutant protein would be the same size by Western as the wildtype protein The nonsense mutant allele would be a different size compared to wildtype by PCR- electrophoresis The nonsense mutant protein would be a different size by Western compared to the wildtype proteinarrow_forward
- The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being amplified. Consider a 10-kbp DNA sequence in agenome of 1010 base pairs. What fraction of the genome does this sequence represent? That is, what is the fractional abundance of this sequence in this genome?Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.arrow_forwardYou are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from cheek cells of different people and amplified by PCR. When viewing the bands on the electrophoresis gel, one would expect that a taster (homozygote) would have---------band(s), whereas a carrier (heterozygote) would show--------band(s), and a non-taster would show------band(s).arrow_forwardThe exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being amplified. Consider a 10-kbp DNA sequence in a genome of 1010 base pairs. What fraction of the genome is represented by this sequence; i.e., what is the fractional abundance of this sequence in this genome? Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.arrow_forward
- You want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map included). After enzyme digestion your amplicon is 854 bp long. What length will the recombinant plasmid be after you have inserted your amplicon? Show a calculation.arrow_forwardWhat is expected theoretical number of copies of DNA molecules after 28 cycles in a PCR experiment? What is the percent efficiency of the PCR experiment if the actual number of copies was 500,000,000? Show your calculationsarrow_forwarda) Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?arrow_forward
- How is the color of the spot coverted into useful data if data is collected from a Vicrochip DNA microarray that's from the colors of spots that illuminate when the spots have a laser shine on them? From the following which one is the best option The color of the spot is converted to a number that represents the intensity of green or red, so that the numerical intensity values can be compared between spots by a computer program The color of the spot is bright so that it can be interpreted visually by trained scientists The color of the spot is present on the chip, counted and a ratio of red-yellow and green-yellow is calculated which can be done by hand The color of the spot can't be converted None of the abovearrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forwardFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY