Anatomy & Physiology
1st Edition
ISBN: 9781938168130
Author: Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3, Problem 17RQ
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT?
- TAGGCGCG
- ATCCGCGC
- CGAATATA
- TGCCTCTC
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Given the following protein, which of the following
sequences of TEMPLATE strand DNA would code for it?
Pay attention to the polarity of the polypeptide and the
strands of DNA that you choose. Use the codon chart to
the right.
AUG = met
AAA = lys
GCU = ala
| CUU = leu
ACU = thr
-lys - thr - ala - leu - met (amino end)
5' TAC GAA CGA TGA TTT TAC ATT 3'
5' ATG CTT GCT ACT AAA ATG TAA 3'
(carboxyl end) met
5' TAC TTT TGA CGA GAA TAC ATT 3¹'
3' TAC TTT TGA CGA GAA TAC ATT 5¹
5' ATG AAA ACT GCT CTT ATG TAA 3¹
3 TAC GAA CGA TGA TTT TAC ATT 5'
Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?
GGATCACGTTACCGCC
TCATAGGCGCCGTTCA
TAAGTACATTACCCCG
GACCGTATGCACGGTC
Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA
TGTGCGCGCGGGGCG
Chapter 3 Solutions
Anatomy & Physiology
Ch. 3 - Visit this link...Ch. 3 - Watch this video...Ch. 3 - Watch this video...Ch. 3 - Watch this video...Ch. 3 - Visit this link...Ch. 3 - Because they are embedded within the membrane, ion...Ch. 3 - The diffusion of substances within a solution...Ch. 3 - Ion pumps and phagocytosis are both examples of...Ch. 3 - Choose the answer that best completes the...Ch. 3 - Choose the term that best completes the following...
Ch. 3 - The rough ER has its name due to what associated...Ch. 3 - Which of the following is a function of the rough...Ch. 3 - Which of the following is a feature common to all...Ch. 3 - Which of the following organelles produces large...Ch. 3 - The nucleus and mitochondria share which of the...Ch. 3 - Which of the following structures could be found...Ch. 3 - Which of the following sequences on a DNA molecule...Ch. 3 - Place the following structures in order from least...Ch. 3 - Which of the following is part of the elongation...Ch. 3 - Which of the following is not a difference between...Ch. 3 - Transcription and translation take place in the...Ch. 3 - How many letters of an RNA molecule, in sequence,...Ch. 3 - Which of the following is not made out of RNA? the...Ch. 3 - Which of the following phases is characterized by...Ch. 3 - A mutation in the gene for a cyclin protein might...Ch. 3 - What is a primary function of tumor suppressor...Ch. 3 - Arrange the following terms in order of increasing...Ch. 3 - Which type of stem cell gives rise to red and...Ch. 3 - What multipotent stem cells from children...Ch. 3 - What materials can easily diffuse through the...Ch. 3 - Why is receptor-mediated endocytosis said to be...Ch. 3 - What do osmosis, diffusion, filtration, and the...Ch. 3 - Explain why the structure of the ER, mitochondria,...Ch. 3 - Compare and contrast lysosomes with peroxisomes:...Ch. 3 - Explain in your own words why DNA replication is...Ch. 3 - Why is it important that DNA replication take...Ch. 3 - Briefly explain the similarities between...Ch. 3 - Contrast transcription and translation. Name at...Ch. 3 - What would happen if anaphase proceeded even...Ch. 3 - What are cyclins and cyclin-dependent kinases, and...Ch. 3 - Explain how a transcription factor ultimately...Ch. 3 - Which of the following structures could be found...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Identify each of the following characteristics as belonging to cervical, thoracic, or lumbar vertebrae; the sac...
Human Anatomy & Physiology (2nd Edition)
In goats, the development of the beard is due to a recessive gene. The following cross involving true-breeding ...
Concepts of Genetics (12th Edition)
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Glyarrow_forwardA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.arrow_forward
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.arrow_forwardWhich of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAAarrow_forwardConvert the following DNA sequences to RNA sequences.Sequence # 1: CCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGGCGACCSequence # 2:CTAAGGTTGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTGSequence # 3:GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTACSequence # 4:CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACGGACATCAGASequence # 5: TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGTTCCGAarrow_forward
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.arrow_forwardGiven several unknown solutions, you are asked to use your knowledge of nutrient tests to identify the unknown substances in the vials. The substances used to create the unknowns are: galactose, olive oil, egg white (albumin), and starch.Each unknown vial contains one or more of these substances. The results of the tests are below. What substances are found in UNKNOWN #2? * Unknown #1 Unknown #2 turns blue after turns blue after Benedict's heating in a water Reagent bath heating in a water bath Sudan IV turns bright red Indicator upon addition turns pale pink upon addition turns brown upon turns black upon Lugol's Solution addition addition turns blue upon addition turns purple upon Biuret addition Reagent Your answerarrow_forwardIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- Garrow_forward
- If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- Garrow_forwardThe sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the + Jend.arrow_forwardA strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the following amino acid sequencesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY