Anatomy & Physiology
1st Edition
ISBN: 9781938168130
Author: Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3, Problem 35CTQ
Explain in your own words why
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
All the following statements about DNA are true, EXCEPT:
O DNA is a double-helix, consisting of a sugar-phosphate backbone.
O DNA is made up on nucleotides, which consist of one sugar, one phosphate, and one base.
O DNA consists of 4 bases - adenine, uracil, cytosine, and guanine.
The two main functions of DNA are to replicate itself and to create proteins (by providing the template for protein synthesis).
O The sugar in DNA is deoxyribose.
Two important proteins in DNA replication are (select two):
Cdx2
Cdt2
Cdc6
Cdc6
Cdt1
Cdc5
Below is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from numbers and end at specific points. Answer the questions relating to the locations specified by the numbers
(1) Which end (5' or 3') of the molecule is here?
(2) Which enzyme is probably functioning here to deal with supercoils in the DNA?
(3) Which enzyme is probably functioning here to unwind the DNA?
Chapter 3 Solutions
Anatomy & Physiology
Ch. 3 - Visit this link...Ch. 3 - Watch this video...Ch. 3 - Watch this video...Ch. 3 - Watch this video...Ch. 3 - Visit this link...Ch. 3 - Because they are embedded within the membrane, ion...Ch. 3 - The diffusion of substances within a solution...Ch. 3 - Ion pumps and phagocytosis are both examples of...Ch. 3 - Choose the answer that best completes the...Ch. 3 - Choose the term that best completes the following...
Ch. 3 - The rough ER has its name due to what associated...Ch. 3 - Which of the following is a function of the rough...Ch. 3 - Which of the following is a feature common to all...Ch. 3 - Which of the following organelles produces large...Ch. 3 - The nucleus and mitochondria share which of the...Ch. 3 - Which of the following structures could be found...Ch. 3 - Which of the following sequences on a DNA molecule...Ch. 3 - Place the following structures in order from least...Ch. 3 - Which of the following is part of the elongation...Ch. 3 - Which of the following is not a difference between...Ch. 3 - Transcription and translation take place in the...Ch. 3 - How many letters of an RNA molecule, in sequence,...Ch. 3 - Which of the following is not made out of RNA? the...Ch. 3 - Which of the following phases is characterized by...Ch. 3 - A mutation in the gene for a cyclin protein might...Ch. 3 - What is a primary function of tumor suppressor...Ch. 3 - Arrange the following terms in order of increasing...Ch. 3 - Which type of stem cell gives rise to red and...Ch. 3 - What multipotent stem cells from children...Ch. 3 - What materials can easily diffuse through the...Ch. 3 - Why is receptor-mediated endocytosis said to be...Ch. 3 - What do osmosis, diffusion, filtration, and the...Ch. 3 - Explain why the structure of the ER, mitochondria,...Ch. 3 - Compare and contrast lysosomes with peroxisomes:...Ch. 3 - Explain in your own words why DNA replication is...Ch. 3 - Why is it important that DNA replication take...Ch. 3 - Briefly explain the similarities between...Ch. 3 - Contrast transcription and translation. Name at...Ch. 3 - What would happen if anaphase proceeded even...Ch. 3 - What are cyclins and cyclin-dependent kinases, and...Ch. 3 - Explain how a transcription factor ultimately...Ch. 3 - Which of the following structures could be found...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The severity of a fall depends on your speed when you strike the ground. All factors but the acceleration due t...
College Physics
CAUTION Why does the presence of extinct forms and transitional features in the fossil record support the patte...
Biological Science
Some organizations are starting to envision a sustainable societyone in which each generation inherits sufficie...
Campbell Essential Biology (6th Edition) - standalone book
QUANTITATIVE Punnett Squares as Genetic Tools. The genetic characters of seed color (where Y is the allele for ...
Becker's World of the Cell (9th Edition)
2 Of the uterus, small intestine, spinal cord, and heart, which is/are in the dorsal body cavity?
Anatomy & Physiology (6th Edition)
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA has unique properties that allow it to accurately retain genetic information, even after multiple rounds of replication. One aspect of DNA that allows it to accurately store genetic information is the base pairing from Chargaff's first rule of the four nucleotide bases. If the A content of a DNA molecule is 18%, what are the percentages of the remaining bases? T = G = C = % % %arrow_forwardDuring DNA replication, cytosine always undergoes complementary base pairing with which of the following nucleotides?arrow_forwardIn DNA polymer, one nucleotide joins with its neighboring nucleotide at 5' carbon. is it true or falsearrow_forward
- Below is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)arrow_forwardA DNA strand consists of any sequence of four kinds of nucleotides. Suppose there were only 14 different amino acids instead of 20. Which of the following statements would be correct descriptions of the minimal number of nucleotides necessary to create a genetic code? a) 1 b)2, provided that chain termination does not require a special codon c) 3, provided that chain termination does require a special codon d)2, no matter how chain termination is accomplished e) Both b and carrow_forwardOne DNA chain of a DNA double helix contains 18% A, 35% T, 28% C and 21% G. What is the composition of the complementary DNA chain? % A: % T: % C: % G:arrow_forward
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forwardDetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsarrow_forwardIf the sequence of one single strand of DNA is C-A-A-G-T-A-G-G-C-T, what is the sequence of the complementary strand? Describe the origin of each strand of the new double helices created after DNA replication. Why is DNA replication important to the growth and development of a multicellular organism? Place the following terms in the correct order from smallest to largest: Nucleosome, supercoils, coils, chromosome, DNA double helixarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY