Answered: Which of the following is not true…

Which of the following is not true about the life-cycle of Fucus. a. 8 eggs per oogonium b. 64 sperm per antheridium c. eggs are flagellated d. sperm are flagellated

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter20: The Protists

Section: Chapter Questions

Problem 11SA

See similar textbooks

Related questions

Q: How does complement promote the immune response? Describe three ways

A: Approach to Solving the Question To answer how the complement system promotes the immune response,…

Q: Following the brief descriptive style we employed in class for Vitamin B12-utilizing enzymes,…

A: Step 1: Step 2: Step 3: Step 4:

Q: how does genetic erosion threatens species survival and ability to adapt

A: Genetic erosion refers to the loss of genetic diversity within a species. It can occur due to…

Q: how would you expect ventricular tachycardia to impact cardiac output?

A: VT, also known as ventricular tachycardia, is a kind of arrhythmia that is distinguished by an…

Q: QUESTION 13 Which of the following white blood cell is the most numerous? Neutrophil O Monocyte O…

A: White blood cells, also known as leukocytes, are a crucial part of the immune system. They help the…

Q: describe how electrofishing works

A: Electrofishing is a scientific survey method used to sample fish populations to determine abundance,…

Q: Draw a linear genetic map of these two genes. Another gene for beetle body color, gene W, is found…

A: Solution:From the provided data, we can determine the recombination frequency between the S and L…

Q: Which of the following is responsible for translocating mitochondrial produced inner membrane…

A: The OXA complex is a protein complex found in the inner mitochondrial membrane. It is responsible…

Q: The sub-atomic particles which possess a positive charge are the:A. protonsB. neutronsC. electronsD.…

A: The question is asking us to identify which sub-atomic particles carry a positive charge. Sub-atomic…

Q: Don't give AI generated solution The genomic DNA information on bovine FABP4 gene is listed below:…

A: The provided genomic DNA information shows the bovine FABP4 gene on chromosome 14, spanning from…

Q: Which of the following events normally activates a GTP-binding protein? OA. GTP hydrolysis by the…

A: Why the other options are incorrect: A. GTP hydrolysis by the proteinWhen the GTP-binding protein…

Q: 2 A linear fragment of DNA containing the Insulin receptor gene is shown below, where boxes…

A: Based on the experiments and expected gel band patterns for each lane, we can draw the following…

Q: Biology B Tutorial Ten-Embryology 3. Using a flow chart, detail the hormonal control of labour. How…

A: Answer well explained above

Q: What is the significance of the electron transport chain in microbial metabolism in terms of the…

A: The electron transport chain (ETC) is a key player in microbial metabolism, acting like a cellular…

Q: What skin layer can I only find in thick skin? What is the most superficial layer of the epidermis?…

A: 1. Stratum Lucidum in Thick Skin: The stratum lucidum is a thin, clear layer of dead skin cells…

Q: a) What differences would you expect to see between the -DNA/+Amp and +DNA/+Amp plates? b)…

A: Approach to solving the question:Analyze these bacterial transformation plates.a) Between the…

Q: Which is not a characteristic of phylum annelida: closed circulatory system, segmentation,…

A: The phylum Annelida is a large group of segmented worms, including earthworms, leeches, and their…

Q: What are Amyloid Fibrils? What biological functions are these known to perform?

A: Amyloid fibrils are highly ordered, insoluble protein aggregates formed by the misfolding of certain…

Q: Why do we test the deep tendon reflexes? Why is obstetrics a field that does a lot of deep tendon…

A: Why Do We Test Deep Tendon Reflexes? Deep tendon reflex (DTR) testing is performed to assess the…

Q: Overview of Transformation Protocol -Prepare competent bacteria for transformation: Treat starter…

A: Detailed explanation:In this experiment, the selectable marker is an antibiotic resistance gene,…

Q: Is there a relationship between growth rates and carrying capacity? Explain. Answer This Question…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: a) Which of the following is not required for PCR? dNTPs bacterial plasmids carefully designed…

A: a) Which of the following is not required for PCR?Answer: Bacterial plasmidsPCR, or Polymerase Chain…

Q: Testing yourself is a helpful way to study, according to Dr. Anne Cleary, an expert in science of…

A: Question: Define the term 'allele'.Answer: An allele is one of two or more versions of a gene that…

Q: If it is assumed that the black dots represent large solid particles, the specific term for the…

A: The process of phagocytosis involves a cell engulfing large solid particles, such as debris,…

Q: Don't give AI generated solution

A: Refer to the solution

Q: 8. Most reactions of anaerobic respiration are similar to a. aerobic respiration b. photosynthesis…

A: Anaerobic respiration refers to the process by which cells produce energy (ATP) without oxygen as…

Q: Patients with multiple sclerosis frequently suffer from blurred vision. Drug X was developed to…

A: The hypothesis developed for the study is that a 20 mg dose of Drug X would be effective for…

Q: b. The coding sequence begins with AUG. What does AUG signify in terms of translation? The Standard…

A: Question b. What does AUG signify in terms of translation?Answer: The AUG codon is the start codon…

Q: Sickle cell anemia is homozygous recessive (aa).

A: 6. Calculating Expected Frequencies:As we discussed earlier, since the aa genotype is lethal, the…

Q: Why is it important to know how much is biodegradableand non-biodegradable?

A: Biodegradable materials are those that can be broken down naturally by microorganisms into simpler…

Q: 5' CCTAGCTTTCCGATAAAGCTATTCAAGT 3' The Alu1 enzyme cuts at this sequence: 5' AGCT 3' sequence. How…

A: To determine how many DNA fragments result from cutting the given DNA sequence with the AluI enzyme,…

Q: The adaptive value is a measure of the evolutionary impacts of a behaviour, i.e. the ultimate…

A: The behaviour of a horse gently swishing its tail and occasionally stomping its feet is a response…

Q: Which is false for echinoderms: water vascular system, no excretory organs, marine habitat only or…

A: Echinoderms are a group of marine animals that include sea stars, sea urchins, sand dollars, and sea…

Q: After oral administration of 10mg of a drug, 50% is absorbed and 40% of the amount absorbed is…

A: 1. Calculate the amount of drug absorbed:Absorbed amount = Total dose * Absorption…

Q: a) When you added the primary antibody to the wells, what happened if the sample contained the…

A: The primary antibody is designed to bind specifically to the antigen of interest. If the sample…

Q: In paragraph form, you should describe what you found. This is not the place to interpret results,…

A: Time Elapsed Between Isopod Survivors and VictimsFigure 1: Time Elapsed for Isopod Survivors vs.…

Q: 1. Explain the Clemenstian paradigm in the context of disturbance and succession. Why have we…

A: Approach to solving the question:1. Explaining the Clemenstian ParadigmStep 1: Define the…

Q: What is the electric field at point A in the figure if d = 2.10 m, R = 0.500 m, 91 = 19.0 nC, and 92…

Q: a) Describe how mRNA and tRNA interact. b)Translate the following mRNA codons: AUG GUU AAC CAG UGA…

A: The interaction between mRNA (messenger RNA) and tRNA (transfer RNA) is a crucial part of protein…

Q: Plaque Formation in Arteries: High levels of LDL cholesterol in the bloodstream can lead to…

A: Health Consequences of Coronary Arteries Being Clogged by PlaquesWhen the coronary arteries become…

Q: what is the guard cell of a stomata?

A: In plants, stomata are tiny openings or pores that are used for gas exchange. They are typically…

Q: Compare the cloning efficiencies: SmaI vs. EcoRI.

A: SmaI1.Recognition Sequence:SmaI recognizes the palindromic sequence 5'-CCCGGG-3' and cuts…

Q: How does stimulating the neuron send a signal to the brain? Please answer questions 3 & 4 only.

A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology

Q: In any given tissue bed, the concentration of C02 (produced from CellularRespiration) would be…

A: The question is asking about the location in the body where the concentration of CO2, produced from…

Q: is often a good indication of phylogenetic relatedness in phenotypes. Life-cycle patterns Cleavage…

A: The question asks for the best indication of phylogenetic relatedness in phenotypes. 1. Life-cycle…

Q: Biology Question

A: 1. Rhythm and Regularity:Regular rhythm: The intervals between each R wave appear consistent,…

Q: Hello, Can you please help me to develope the "Toxic shock syndrome" please? overview of the…

A: Toxic Shock Syndrome (TSS) OverviewToxic Shock Syndrome (TSS) is a rare but critical illness caused…

Q: What are “domains” and how do they aid in protein function?

A: Domains are crucial in protein function for several reasons:Modularity: Domains allow for a modular…

Q: Which of the following bones possesses the external auditory meatus?a. frontalb. occipitalc.…

A: The question is asking us to identify which bone in the human body contains the external auditory…

Q: 4. (10 points) woman. If both disease traits are X-linked recessive what is the probability A man…

A: Part (a): Complete Linkage Complete linkage implies that the genes for hemophilia and colorblindness…

Question

Which of the following is not true about the life-cycle of Fucus.

		a. 8 eggs per oogonium
		b. 64 sperm per antheridium
		c. eggs are flagellated
		d. sperm are flagellated

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Similar questions

Meroblastic cleavage is typical of embryos formed from __________ eggs, (a) moderately telolecithal (b) highly telolecithal (c) isolecithal (d) b and c (e) a, b, and c
Which parasitic protist evades the host immune system by altering its surface proteins with each generation? a. Paramecium caudatum b. Trypanosoma brucci c. Plasmodium falciparum d. Phytophthora infrstans
The process of gastrulation forms the _______. a. blastula b. zygote c. organs d. germ layers
The presence of a contractile vacuole indicates that a single-celled protist _______. a. is marine c. is photosynthetic b. lives in fresh water d. secretes a toxin
What is a likely evolutionary advantage of sexual reproduction over asexual reproduction? a. sexual reproduction involves fewer steps b. less chance of using up the resources in a given environment c. sexual reproduction results in greater variation in the offspring d. sexual reproduction is more cost-effective
Hermaphroditism (a) is a form of asexual reproduction (b) occurs when an unfertilized egg develops into an adult animal (c) is a form of sexual reproduction in which an animal produces both eggs and sperm (d) typically involves self-fertilization (e) typically requires only a male animal
Figure 18.17 Which of the following statements about hormone regulation of the female reproductive cycle is false? a. LH and FSH are produced in the pituitary, and estrogen and progesterone are produced in the ovaries. b. Estradiol and progesterone secreted from the corpus luteum cause the endometrium to thicken. c. Both progesterone and estrogen are produced by the follicles. d. Secretion of GnRH by the hypothalamus is inhibited by low levels of estrogen but stimulated by high levels of estrogen.
Which type of life cycle has both a haploid and diploid multicellular stage? a. an asexual life cycle b. diploid-dominant c. haploid-dominant d. alternation of generations
Figure 14.19 At what stage does the diploid zygote form? a. When the female cone begins to bud from the tree b. When the sperm nucleus and the egg nucleus fuse c. When the seeds drop from the tree d. When the pollen tube begins to grow
Meiosis ________. a. occurs only in germ cells of animals b. supports growth and tissue repair in multicelled species c. gives rise to genetic diversity among offspring d. is part of the life cycle of all cells.
Figure 23.25 Which of the following statements about Paramecium sexual reproduction is false? The macronuclei are derived from micronuclei. Both mitosis and meiosis occur during sexual reproduction. The conjugate pair swaps macronuclei. Each parent produces four daughter cells
Which of the following does not occur? a. radially symmetrical diploblast b. diploblastic eucoelomate c. protostomic coelomate d. bilaterally symmetrical deuterostome