a) When you added the primary antibody to the wells, what happened if the sample contained the antigen? What if it did not contain the antigen?    b) When you added the secondary antibody to the wells, what happened if the sample contained the antigen? What if it did not contain the antigen?    c) If your sample gave a negative result for the antigen does this guarantee the antigen is not present? What reasons could there be for a negative result when the antigen is actually present?

Q: Overview of Transformation Protocol   -Prepare competent bacteria for transformation: Treat starter…

A: Detailed explanation:In this experiment, the selectable marker is an antibiotic resistance gene,…

Q: What is electrical potential? Describe two reasons that the resting membrane potential is negative.…

A: Electrical potential is a measure of the potential energy per unit charge in an electric field. In…

Q: a) What are the names of the enzymes that add acetyl groups to histones and what are the names of…

A: The enzymes that add acetyl groups to histones are called histone acetyltransferases (HATs). They…

Q: 1. A) Suppose that you crossed purple corn vs yellow corn and you got an F2 generation consisting of…

A: 1. HypothesesNull Hypothesis (H₀): The observed distribution of purple and yellow kernels follows…

Q: a) The amino acid sequence of the alpha chain terminates with a *.  What does this symbol mean? b)…

A: In the context of amino acid sequences, the * symbol is used to denote the termination of the…

Q: Hello, Beside this, what else do you think I can say about "Staphylococcus aureus"? "is a common…

A: To add more detail about Staphylococcus aureus, you could expand on its characteristics, modes of…

Q: a) Draw a DNA replication fork and label the polarity of your DNA (you decide which strand is 3’à5’…

A: Ans ----1. DNA Polymerase IFunction: DNA Polymerase I primarily participates in DNA repair and…

Q: What is the difference in effect of alpha 1 adrenergic receptors and beta 2 adrenergic receptors on…

A: Question #1:Here's a simple table to summarize the comparison between alpha-1 and beta-2 adrenergic…

Q: Discuss one of the possible benefits of psychedelics on the treatment of mental and emotional…

A: Psychedelics are a class of drugs that produce changes in perception, mood, and cognitive processes.…

Q: What is most likely to occur when both on metoprolol and verapamil  a. kidney issues b. slow heart…

A: Metoprolol and Verapamil are both medications used to treat high blood pressure and heart…

Q: Laws of Reflection states that ..............

A: Step 1: Step 2: Step 3: Step 4:

Q: a) Write a short description of why someone would choose to write about wolves vs. dogs. Make an…

A: Wolves and dogs share a common ancestry, with dogs being domesticated from wolves. This makes the…

Q: 1. Which serratus posterior muscle would be considered a synergist with the internal intercostals…

A: 2. What muscle is the prime muscle of the "six-pack"? What feature gives this muscle its…

Q: please help using excel

A:

Q: a) How are the model single nucleotides structurally different than real-life dNTPs? b)If you wanted…

A: Model single nucleotides are simplified representations of real-life deoxyribonucleotide…

Q: Answer the following using Branch Diagrams using a set of completely made-up human characteristics…

A: Step 1:Step 2: Branched DiagramTo find the genotype ratio, just follow the line and multiply the…

Q: What is the role of thermodynamics in microbial metabolism in Gibbs free energy and its importance…

A: Thermodynamics is a branch of physics that deals with the relationships between heat and other forms…

Q: Given the following sequence on the coding strand of prokaryotic DNA, provide all of the following…

A: Answer:DNA Template Strand: 3' TACGCTGATCCAAACGGCCTACCTAC 5'mRNA:               5'…

Q: Table 6-3. Group F, results. PHENOTYPE OF F2 PROGENY Light brown, Red, Normal YOUR DATA PARTNER #1…

A: Step 1: Understanding the DataThe table is labeled "Group F₂ results," indicating this data pertains…

Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options.

A: Step 1.  Electron Transfer from FADH₂ Process: FADH₂ donates electrons to the electron transport…

Q: Realted to the experiment of the unknown organic substances which are citric acid, acetone, urea,…

A: c) Then the next step in the flow chart was the pH. What were you expecting to identify or separate…

Q: Don't use Ai and chatgpt. Answer in step by step with explanation.

A: Step 1: Step 2: Step 3: Step 4:

Q: a) In a scientific research article, what is the purpose of the introduction?   b) Scientific papers…

A: Answer well explained above

Q: Draw the enol form of Thymine, and show how this tautomer could form a Watson-Crickbase pair with…

A: Approach to solving the question:This shows the rare enol tautomeric form of Thymine base-pairing…

Q: Which of the structures may represent aquaporins

A: Ans: Aquaporins are integral membrane proteins that form channels in the cell membrane, facilitating…

Q: Don't upload image. Answer in step by step with explanation. Don't use Ai and chatgpt

A: Step 1. Relative Water Level: 45 Explanation: At this level, the mouse population cannot sustain…

Q: Use this diagram to answer the following questions.

A: The phase diagram shows the relationship between pressure and temperature for Substance X. The…

Q: Biology B Tutorial Seven- Nervous and Endocrine System Compare this summary to the tables provided…

A: Answer well explained above

Q: True or False? a.____If a restriction enzyme recognizes the restriction site, 5’AACGTT3’, and the…

A: 1. Restriction Enzyme Recognition and Sticky EndsRestriction enzymes, also known as restriction…

Q: Which is most likely to be true for someone with defective A-beta fibers? A) Unable to feel pain in…

A: A-beta fibers are large, myelinated nerve fibers primarily responsible for transmitting touch and…

Q: Which of the following scientific investigations may use a compound light microscope? (check all…

A: A compound light microscope is a type of microscope that uses light and lenses to magnify images. It…

Q: Hello, Can you please help me to explain What are some of the symptoms of the flu? What are some of…

A: Approach to Solving the Question:To provide a detailed answer about flu symptoms and complications,…

Q: Hello, Can you please help me with a brief summary of the next video including a list of the major…

A: Summary of the Immune ResponseThe immune system defends the body against pathogens like bacteria,…

Q: Hello, Can you please help me with an overview of Microbemia. A description of the causative agent,…

A: An Explanation of MicrobacteriaIt is a general medical term that is used to describe the presence of…

Q: Tarzan and Jane are both normal, but their first child is affected with heroism, an autosomal…

A: Solution:The required pedigree created including all the information given in the question, is…

Q: What is the principal difference in the shape of a monocot leave in contrast to a non non-monocot…

A: 1. Structure of a Non-Monocot (Dicot) LeafDicot leaves are designed for photosynthesis and have…

Q: In a particular plant species, single genes determine flower color and plant height and the genes…

A: a. Alleles and Genotypes:The allele for short height (s) is dominant over the allele for tall height…

Q: QUESTION 7 The three parameters in steam sterilization in an autoclave are... Oa. Steam under…

A: The correct answer is a. Steam under pressure, time, temperature. These are the three critical…

Q: a) Suppose a married couple comes to you for counseling.  Both of them have a genetic disorder, but…

A: For the first couple, if both parents have the genetic disorder, it suggests that the disorder is…

Q: Select the answer that correctly arranges the following elements of a eukaryotic gene from upstream…

A: The correct order of elements in a eukaryotic gene from upstream to downstream is as follows:B. TATA…

Q: Insert a picture of ONE type of cartilage (microscopic level). Which type did you pick? 2.  A…

A: Question 1I picked Hyaline Cartilage, which is the one most abundantly found in human body. You can…

Q: Below is an image of a dividing onion root tip cell undergoing mitosis. In what phase of mitosis is…

A: Telophase in onion root tip cells is a fascinating process that marks the conclusion of mitosis.…

Q: Clumsy Bob fell down the stairs and broke his crown. Name a cranial bone he might have broken…

A: 1. Cranial Bone Bob Might Have Broken:If Bob fell and hit his head, especially the "crown" area, he…

Q: a) Through which method of intercellular signaling do motor neurons communicate with muscle fibers?…

A: A:Method of Intercellular Signaling: Motor neurons communicate with muscle fibers via synaptic…

Q: 5. The image below shows the organization of a type IV protein that resides on the ER membrane. The…

A: Based on the given diagram and instructions, here is a detailed explanation and breakdown of how to…

Q: Provide the following measures: incidence rate, cause-specific rate, age-specific death rate, and…

A: The incidence rate is a measure of the risk of developing some new condition within a specified…

Q: In another question, you explained the classical monocot leaf pattern. However, in this life…

A: The plants Poa pratensis (Kentucky bluegrass) and Zea mays (maize) are both monocots, meaning they…

Q: In your own words, describe the difference between weathering and erosion.

A: Weathering is the process where rocks and minerals on Earth's surface are broken down into smaller…

Q: Check the box under each structure in the table that is an enantiomer of the molecule shown below.…

A: Enantiomers are the two molecules having the same molecular formula, but there structures are mirror…

Q: Describe at least four cancer diagnoses that have been linked to the work environment,

A: Lung Cancer: This is one of the most common types of cancer linked to the work environment. It is…