Given the following sequence on the coding strand of prokaryotic DNA, provide all of the following with 3’ and 5’ polarity where appropriate: template strand, mRNA, t-RNA anticodons, polypeptide sequence produced (codon chart provided on next page). 5’ ATGACGCTAGGGTTTGCCAGATGGTGA 3’
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Given the following sequence on the coding strand of prokaryotic DNA, provide all of the following with 3’ and 5’ polarity where appropriate: template strand, mRNA, t-RNA anticodons, polypeptide sequence produced (codon chart provided on next page).
5’ ATGACGCTAGGGTTTGCCAGATGGTGA 3’
Step by step
Solved in 2 steps
