FORD Staples. Table 1. normal protein 1 2 Frameshift mutation worksheet 35 DNA 3' ATTGTGTACTAAAAGCATTTTACAGACTGAAGGTTG RNA 5' UAACACAUGAUUUUCGUAAAAUGUCUGACUUCCAAC protein MET ILE PHE VAL LYS CYS LEU THR SER ASN Table 2. deletion at position #2 1 3 5 RNA 5' AAACAUGAVUUUCGUAAAAVGVCUGACUUCCAAC protein THR H PHESER ASNVAL LEUPRO
Q: *Do not use the picture I sent yet*____ Secondary production occurs after primary production, after…
A: Secondary production refers to the biomass (the total mass of organisms in a given area or volume)…
Q: Even if our brain had the capacity to interpret all the sensory information accurately and in…
A: In case you need further information, here's a thorough discussion: Even if our brain could…
Q: had enough water Lesson Checkpoint Can you list the potential effects on a plant after growing in…
A: Refer to the solution
Q: Question 3 (Mandatory) (6 points) You observe a newly-abandoned farm field. Make a prediction of how…
A: A comprehensive response, complete with appropriate explanations and reasoning has been provided in…
Q: While the SA node is considered the pacemaker of the heart, the AV node is also capable of…
A: I have provided you the template and example and all the context where you can extract and improvise…
Q: Define descriptive and inferential statistics, and briefly explain how they are different.
A: Descriptive statistics is a branch of statistics that involves the organization, summarization, and…
Q: Total Parenteral Nutrition (TPN) is ordered for a 47 year old male patient is 6 ft 2 in tall and…
A: The total calories provided by the amino acids and the lipid emulsion can be calculated by adding…
Q: Topic: You will choose a medical condition related to one of the anatomical systems we covered in…
A: Smoking is the main cause of Chronic Obstructive Pulmonary Disease (COPD), a chronic respiratory…
Q: Do not use chatgpt.
A: To determine which isozyme has the highest Vmax (maximum enzyme activity), we use the…
Q: Build a simplified model of the process of meiosis and an accompanying list of key terms, use this…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: What are some possible ways that humans could mitigate the effects of cnidarians?
A: Cnidarians, which include species like jellyfish, corals, and sea anemones, can pose various…
Q: • Is this anabolism or catabolism? • Can you describe the movement of electrons? plasma membrane…
A: A comprehensive response, complete with appropriate explanations and reasoning has been provided in…
Q: Make a claim or observation about dead zones and nitrogen input in the Chesapeake Bay that is…
A: Approach to solving the question:The correlation between dead zones and nitrogen input in Chesapeake…
Q: Think 2 questions about evolution that you have but which Darwin, Wallace, and Mendel did not…
A: Here are two questions about evolution that neither Darwin, Wallace, nor Mendel fully addressed, but…
Q: Although there can be individuals born with only a single X chromosome, there are not individuals…
A: The X chromosome is one of the two sex chromosomes in humans (the other is the Y chromosome). It is…
Q: = Menu #2 Mol Bio Mutation QU... X + Create All tools Edit Convert E-Sign Q Search Complete the…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: Charlotte Auerbach (1899-1994), who was a pioneering German-born geneticist who made significant…
A: Approach to solving the question: To effectively answer the question regarding Charlotte Auerbach's…
Q: Explain some of the factors that influence your food choice ?
A: One of the most significant factors that influence food choices is personal preferences. These…
Q: The action of the bronchodilator aims at opening blocked or closed airways. This helps the patient…
A: A) Restoring blood flow to those alveoli:Incorrect. The primary action of bronchodilators is to…
Q: Match the following scenarios with the best term. You will probably need to look this stuff up in…
A: Here are the matches for the scenarios with the best corresponding terms: Often a result of…
Q: What region of the body is the vertebral column found in?Is this dorsal or ventral?What major organs…
A: The vertebral column, also known as the spine, plays a critical role in the human body. It is…
Q: DOES THIS SOURCE PASS THE CRAAP TEST? Stephenson, Judith, et al. "Before the Beginning: Nutrition…
A: The CRAAP test is a framework used to evaluate the credibility and reliability of information…
Q: What is the difference between apoptosis and necrosis? Name and describe one way to hold cells…
A: Approach to solving the question:Researched through Books and online resources/ reference with…
Q: Routes of Drug Administration are how drugs get into the body. Compare 4 different routes of drug…
A: Oral administration is the most common route of drug administration. It involves swallowing a drug…
Q: This video explains some of the biology of the inherited disease, cystic fibrosis, caused by…
A: Detailed explanation:The underlying cause of cystic fibrosis, a genetic disease that mainly affects…
Q: Reverse osmosis uses extreme pressure to force water through many layers of selectively permeable…
A: Osmosis is a natural process that occurs when two solutions of different concentrations are…
Q: Daly made significant contributions to the study of nucleic acids in addition to her work on…
A: The text provides information about the significant contributions of a scientist named Daly. She…
Q: Don't use Ai and chatgpt. Answer in step by step with explanation.
A: A. Epithelial cells form continuous layers of tightly packed cells.Explanation: Epithelial cells are…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt.
A: a. Which bear will natural selection select AGAINST?Natural selection will select against the bears…
Q: Do not use chatgpt
A: Solution:The null hypothesis in experimental studies is a general statement that stipulates that…
Q: Biology B Tutorial Eight-Renal System 4. Control of sodium ion concentration is essential in…
A: Answer well explained above
Q: Refer back to the information about R-E-C tables from your pre-lab activity to answer Question 1. A…
A: First, identify the information that reinforces your previous knowledge. This is the information…
Q: A patient is taking codeine as two 15 mg tablet(s) by mouth every 24 hours. The prescribing…
A: The patient is taking two 15 mg tablets of codeine every 24 hours. Therefore, the total daily dose…
Q: A person with blood type O and heterozygous for the Bombay phenotype mutation marries a person with…
A: The Bombay phenotype is a rare variant of the ABO blood group system. People with this phenotype do…
Q: Which show radial symmetry annelids, vertebrates,echinoderms, none or all?
A: In biology, symmetry refers to the balance in proportions of the body and its parts. Radial symmetry…
Q: True or False: in meiosis the intermediate cells formed after meiosis I are haploid going into…
A: Here's a detailed explanation:Meiosis consists of two consecutive divisions: meiosis I and meiosis…
Q: Describe the applications of epidemiology and toxicology in occupational health.
A: Epidemiology is the study of how often diseases occur in different groups of people and why. It…
Q: 10. Examine this image of a sample that was streaked using the quadrant streak isolation technique.…
A: Detailed Analysis of a Mixed Culture on Nutrient AgarA mixed culture, as seen in the image provided,…
Q: In some plants, a purple pigment is synthesized from a colorless precursor. In a cross between two…
A: The question is asking us to determine the mode of inheritance and the phenotypic ratio based on the…
Q: What is the difference in effect of alpha 1 adrenergic receptors and beta 2 adrenergic receptors on…
A: Question #1:Here's a simple table to summarize the comparison between alpha-1 and beta-2 adrenergic…
Q: year. arses/38105/quizzes/220159/take Explain why there is such a difference in the amount of CO2…
A: Mauna Loa is actually located in the Northern Hemisphere, but the options provided seem to reference…
Q: 2. Hello, Can you please help me to describe (short description) the life cycle of Enterobius…
A: To help you visualize the life cycle of Enterobius vermicularis, you may refer to this image:…
Q: MATCH THE FOLLOWING TERMS TO THE BLANKS IN THE FOLLOWING PASSAGE: A group of tourists become…
A: Here are the answers to the blanks in the passage:1. a. Genetic drift2. b. mutation3. c. gene flow4.…
Q: Pick one of the three sections marked in the graph (A, B, or C) and explain why you see the trend…
A: Before we can explain the trend in any of the sections, we first need to understand what the graph…
Q: Don't use Ai/ chatgpt. Answer in step by step with explanation.
A: Detailed explanation: Carriers:Carriers, also known as transporters, are proteins embedded in the…
Q: You may have heard the "fact" that snails and slugs "melt" when exposed to salt. A snail's mantle…
A: Refer to the solution
Q: Genes on the X-chromosome mostly have nothing to do with biological sex determination. How many…
A: The X chromosome is one of the two sex chromosomes in humans (the other is the Y chromosome). It is…
Q: Is a primer required for RT-PCR? Why or why not?
A: Yes, a primer is required for RT-PCR.RT-PCR (Reverse Transcription Polymerase Chain Reaction) is a…
Q: Results 1: A total of 30.87 Gb of paired reads that were 125 bp long were obtained using RNA‐Seq.…
A: The results presented are from a comparative genomic study between dogs and wolves using RNA-Seq, a…
Q: Una cassa di 3 kg si trova all' altezza di 4m. Calcola la sua energia potenziale (in joule).
A: Approach to solving the question:Please see attached photos for detailed solutions. Thank you.…
Based on table 1, whats the RNA 5’ sequence with an addition at position 5? The existing DNA base is T and the mutation to DNA is insert A to its right.
Step by step
Solved in 2 steps
- Please help asap encoded text form please not handwritten thank you48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letterDo not use Ai
- helpp, if u could do this one first pleasePart B/D?RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
- me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…Complete number five.. please explainpcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
- Question in Image. Thank you!100All tRNA molecules have poly (A) tails at their 3' end. YesornoCynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G