In another question, you explained the classical monocot leaf pattern. However, in this life collection, you have some deviant taxa: monocot leaves with a what seems to be a distinct "Lamina" and a "Petiolus". Into the essay field, enter the Latin name of two of these deviant monocot leaves presented. (Points for this question will be given later manually) Leaf of Poa pratensis or Zea maize: To which angiosperm group do both plants belong To which families do both belong Is the leaf bifacial or unifacial? On which side of the leaf do stomata occur? On which side of the leaf is the palisade parenchyma differentiated? PICK ONLY ONE OPTION: 1.) Basal angiosperms Eudicots Monocots 2.) FILL IN THE BLANK 3.) bifacial unifacial 4.)upper adaxial lower abaxial both 5.) upper adaxial lower abaxial not differentiated
Q: Below is another image of dividing onion root cells undergoing mitosis. In what phase of mitosis is…
A: Mitosis is the process by which a eukaryotic cell divides its nucleus and separates its chromosomes…
Q: Explain some of the factors that influence your food choice ?
A: One of the most significant factors that influence food choices is personal preferences. These…
Q: which is a vertebrate: cray fish, globe fish, devil fish or cuttle fish
A: A vertebrate is an animal of a large group distinguished by the possession of a backbone or spinal…
Q: A patient develops sudden breathing problems after recently increasing his workouts. He presents…
A: The Hemoglobin-Oxygen dissociation curve illustrates the relationship between the partial pressure…
Q: History of biology
A: Detailed explanation:The history of biology is a fascinating journey that traces the evolution of…
Q: Following the brief descriptive style we employed in class for Vitamin B12-utilizing enzymes,…
A: Step 1: Step 2: Step 3: Step 4:
Q: Total Parenteral Nutrition (TPN) is ordered for a 22 year old female patient is 6 ft 3 in tall and…
A: First, we need to convert the patient's weight from pounds to kilograms and height from feet and…
Q: Are the number of species of chordates: 30 000, 40 000, 45 000 or 50 000?
A: The estimated number of species of chordates is approximately 50,000. This includes various groups…
Q: DNA Fingerprinting Experiment Daughter Mother Possible Fathers Horse Horse 1 2 3 4 Which stallion…
A: DNA fingerprinting involves analyzing the DNA bands of the mother, the daughter, and potential…
Q: (a) Give one reasons why you would want to use the Library databases to search for primary research…
A: Library databases are preferred over general internet searches for several reasons when conducting…
Q: How does ancestry and race play into disease genetics?
A: Disease genetics refers to the study of how genetic variations contribute to the development of…
Q: Hello, Can you tell me any curiosity about Pseudomonas Aeruginosa? Thank you in advance!
A: References:https://www.ncbi.nlm.nih.gov/books/NBK557831/https://www.ncbi.nlm.nih.gov/pmc/articles/PM…
Q: Using the graph above, identify the independent and dependent variable.
A: In any experiment or observation, the independent variable is the factor that is manipulated or…
Q: In the Bradford protein determination, the color of a dye changes from brown to blue when it binds…
A: Step 1:Beer's law equation is A=ϵClA is absorbance, C is concentration.Now Absorbance is the…
Q: MATCH THE FOLLOWING TERMS TO THE BLANKS IN THE FOLLOWING PASSAGE: A group of tourists become…
A: Here are the answers to the blanks in the passage:1. a. Genetic drift2. b. mutation3. c. gene flow4.…
Q: Given the following sequence on the coding strand of prokaryotic DNA, provide all of the following…
A: Answer:DNA Template Strand: 3' TACGCTGATCCAAACGGCCTACCTAC 5'mRNA: 5'…
Q: Life is often said to exhibit emergent properties—properties that a system has that the components…
A: Emergent properties refer to the complex characteristics that arise when individual components…
Q: Please label the diagram
A: This is an illustration of a cell membrane. A cell membrane (or plasma membrane) separates the…
Q: Hexokinase phosphohexose isomerase [Choose ] [Choose ] Is not the trapping reaction catalyzes an…
A: Here is the matching of the glycolytic enzymes with the appropriate…
Q: 1. Mode of inheritance: Assume the trait is rare in the population. ONE mode applies to all 3…
A: Step 1: Determining the Mode of InheritanceFrom the image, we can see:Both males and females are…
Q: Using the the Figure attached, please answer these questions1.a. define filopodia 1.b. define…
A: 1.c. Indicate Where There Are Induced Filopodia on the Cells in A, B, C, and Dyou can observe…
Q: The Delta variant of SARS-CoV-2 was first discovered in India in October of November 2020. By the…
A: Part 1: Calculate the Maximum Number of GenerationsWe are given the following information:The virus…
Q: Clumsy Bob fell down the stairs and broke his crown. Name a cranial bone he might have broken…
A: 1. Cranial Bone Bob Might Have Broken:If Bob fell and hit his head, especially the "crown" area, he…
Q: Cyanobacgeria are capable of photosynthesis, so they are usually called blue-green algae. a) true…
A: Detailed explanation:the statement "Cyanobacteria are capable of photosynthesis, so they are usually…
Q: Note a horse animal behaviour at the Central Experimental Farm in Ottawa on at least four (4)…
A: Here's a more detailed explanation of the horse behaviors observed at the Central Experimental Farm…
Q: 2. Hello, Can you please help me to describe (short description) the life cycle of Enterobius…
A: To help you visualize the life cycle of Enterobius vermicularis, you may refer to this image:…
Q: You are working in a lab that synthesizes metabolic inhibitors, you are asked to explain your two…
A: Approach to solving the question: Detailed explanation:Here are two potential explanations,…
Q: Define descriptive and inferential statistics, and briefly explain how they are different.
A: Descriptive statistics is a branch of statistics that involves the organization, summarization, and…
Q: What impact does st john wort have on dabigatran
A: St. John's Wort is a plant that is often used in herbal medicine, particularly for treating…
Q: If the pedigree below shows an autosomal recessive mode of inheritance, which individuals must be…
A: In the pedigree shown in the image, autosomal recessive inheritance is being considered. Autosomal…
Q: Victim Suspect 1 Suspect 2 Crime Scene 1 Crime Scene 2 Assuming both crime scene samples came from…
A: As it is evident in the gel, that the DNA bands of crime scene 1 are similar to suspect 2. On the…
Q: Biology Question
A: This image shows an electrocardiogram (ECG or EKG) strip, which is a graphical representation of the…
Q: Explain why drinking saltwater causes diarrhea and dehydration. Describe the difference between the…
A: 2. Difference Between the Size of Bacteria and the Size of a Salt IonBacteria are much larger than…
Q: How does the number of genes in the microbiome compare to the number in the human or the rice plant?…
A: 1. Number of Genes in the Microbiome vs. Human and Rice Genome: The microbiome, particularly the gut…
Q: 2). What is the maximum frequency of recombinant gametes? Illustrate this in an F1 individual with 2…
A: The maximum frequency of recombinant gametes is 50%. This occurs when two genes are far enough apart…
Q: Compare and contrast inbreeding and outbreeding depression?
A: Inbreeding depression is a reduction in biological fitness that is the result of breeding closely…
Q: What is the difference between a fibrous, cartilaginous, and a synovial joint? How are the two…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: How do I draw a diagram for Phosphoenolpyruvate (PEP) + ADP → Pyruvate + ATP to show the effect of…
A: The reaction you're referring to is a key step in the process of glycolysis, where…
Q: Unknown #3: Indole: Positive MR: Positive Citrate: Negative MAC: Colorless colonies XLD: Translucent…
A: The given test results are a series of biochemical tests used in microbiology to identify an unknown…
Q: QUESTION 20 .All of the following stains we will use in lab are O A. Negative OB. Differential OC.…
A: First, let's understand the nature of the stains mentioned: methylene blue, safranin, crystal…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt.
A: a. Which bear will natural selection select AGAINST?Natural selection will select against the bears…
Q: A male Drosophila from a wild-type stock is discovered to have only 7 chromosomes, whereas normally…
A: Part (a): Diagram of Chromosomes in the Male Fly During Synapsis in Meiosis IThe male Drosophila in…
Q: 15. Imagine evolution of allele frequencies on an island under these conditions: **The population on…
A: This is the strategy that should be used in order to answer each issue based on the principles of…
Q: Biology Question
A: Explanation of this ECG strip 1. Rhythm and Rate: The rhythm appears regular, with consistent…
Q: 2 and 3 please
A: 2. Mother's Genotype: The mother has blood type AB. This means her genotype is AB (one A allele and…
Q: Hello, Can you please help me to describe the major characteristics of "Hodgkin’s lymphoma" (or…
A: Detailed explanation:Hodgkin's lymphoma, also called Hodgkin's disease, is one of the more common…
Q: In what procedure(s) might the degenerate base code be important?
A: Approach to solving the question: Detailed explanation: 1. PCR or Polymerase Chain…
Q: what is the correct description for the image. this is a practice problem
A: Approach to solving the question: Detailed explanation:Atrial flutter. Multiple waves appear between…
Q: Answer this
A: QUESTION 3:What happened to the mussel species in the intertidal community when sea stars (a top…
Q: (a) what is happening in METAPHASE II? Include Crossing Over and Independent Assortment when they…
A: Metaphase IIIn Metaphase II, the chromosomes line up along the cell's equatorial plane, known as the…
Step by step
Solved in 2 steps
- Although potato tuber is an underground plant part, it is considered asa stem. Give two reasons.Answer the following: 1. Does raphanus sativus, Pachyrrisus esosus, Beta vulgaris and Daucus carota are monocot or dicot? 2. What are the root system of the aforementioned plants? 3. Is there any modification of these aforementioned plant? 4. What are the functions of these plants?(See attached for image...) Is this an image of a plant root or plant stem? Justify your answer. Is this specimen from a monocot or a eudicot? Justify your answer.
- Show the sequence of secondary growth by drawing the row of cells from the boxed area below and labeling the vascular cambium cell (V), 5 xylem cells from oldest (X1) to youngest (X5), and 3 phloem cells (P1 to P3). Show what happens after growth continues by drawing and labeling a row with twice as many xylem and phloem cells. How does the vascular cambium’s location change? A pear has a hard texture but juicy. State two cells that give the characteristics? State the function of the transitional epithelium found in the mammalian urinogenital system. (i) Identify type of tissue lines the air sacs of the lungs. (ii) Explain how the tissue named in (i) adapted to its function.Below is a series of pictures of monocot a leaf (x.s.), Zea mays. 40x (x.s.) Make a sketch of the 40x leaf cross section and upload it here with the following structures labeled: upper epidermis, bulliform cells (large cells on upper leaf surface), stomate, guard cells, mesophyll, xylem, phloem, bundle sheath cells, lower epidermis MacBook ProBelow is a series of pictures of the stem (x.s.) of a corn, Zea mays. 40x (x.s.) 100x (x.s.) Make a sketch of both magnifications (40x and 100x) and upload it here with the following structures labeled: epidermis, sclerenchyma (fibers), ground tissue parenchyma, vascular bundles, phloem, xylem, sieve tube members, companion cells, vessel elements, tracheids
- Determine the collective true-false status of the statements using the choices below. I. The vascular bundles of monocot stems are typically distributed all throughout the ground tissue.; II. The vascular bundles inside a typical eudicot stem are arranged in a characteristic ring.; III. Bulbs are stems that branch from the main stem of the plant and grow horizontally on the ground or just under it.; IV. Allium cepa is a plant with a bulb stem. Only two (2) statements are true. Only three (3) statements are true. Only one (1) statement is true. None of the statements is true. All statements are true.What is the principal difference in the shape of a monocot leave in contrast to a non non-monocot leaf? In a cross section through a non-monocot leaf... on which side of the vascular bundle is the xyleme? on which side of the leaf is the palisade parenchyma? this is the on which side of the leaf is the spongy parenchyma? ; this is the PICK ONE OPTION ONLY: 1&2.) lower side upper side both sides equally 3.) abaxial side adaxial side 4.) lower side upper side both sides equally 5.) abaxial side adaxial side Check with Photosynthesis in Mauseth 10, Raven 7, Campbell Reece 10: The palisade parenchyma is with and with The spongy parenchyma is with and with PICK ONLY ONE OPTION: 1.)high OR Short globular 2.)dense OR Loose 3.)rich ✰ cells that are chlorophyll. Gas exchange is ÷ ✰ cells that are chlorophyll. Gas exchange is ÷ Poor No 4.) required to discharge oxygen required to discharge carbon-dioxide required to acquire oxygen required to acquire carbon-dioxide not required 5.) high or Short…two leaves A and B, each having the petiole in a closed test tube full of water. Each is hung on a spring balance. Leaf A has a waxy cuticle on the upper epidermis and stomata on the lower epidermis. Leaf B a waxy cuticle on the upper epidermis and a lower epidermis covered with petroleum jelly. Both leaves were cut from the same plant. i)Explain why it is important for the leaves to be cut from the same plant. (ii) List TWO variabes that must be kept constant in this investigation. iii) Table 6 shows the results obtained in the experiment: leaf and test tube weight final weight change in weight A 40.7 39.9 0.8 B 38.7 38.7 0.0 Explain why the weight of set up A, decreased. iv) Using your biological knowledge, indicate how results will change, if a fan is switched on near the experimental set up. Explain your answer.
- please answer these questionsAn angiosperm called “ghost plant” does not produce chlorophyll orother photosynthetic pigments and is almost completely white. Basedonly on this information, what assumptions can you make about ghostplants?READ THE FOLLOWING INSTRUCTIONS: Bryophytes in which the gametophytes are "leafy" in appearance and the sporophytes grow conspicuously from the tips of the gametophyte plants. STEP 1: Examine the mass of moss plants and then select one or two individual gametophyte plants and note the leaf-like (not true leaves because they lack conducting tissue) structures which are arranged around a central, vertical "stem-like" stalk and root-like rhizoids which anchor the plant and absorb water and nutrients. STEP: The sex organs are in the tips of the plants and must be seen with the microscope. Study a slide of a vertical section through head of a mate plant and note the many antheridia. STEP 3: Examine a slide through a vertical section of a female plant. Note the many upright archegonia each on a tall stalk and each with a swollen base or venter containing an egg and an elongate neck. Note the filamentous paraphyses between the archegonia. STEP 4: Examine a living or preserved…