Using the the Figure attached, please answer these questions1.a. define filopodia 1.b. define contact sites 1.c. indicate where there are induced filopodia on the cells in A, B, C and D; (draw a circle around them or add an arrow to indicate their location; DO NOT CIRCLE THE ENTIRE CELL)1.d. name the cell types (name of the cell line) used in A, B, C and D 1.e. what kind of microscopy was used to capture these images? ABCDFigure 8 Induction of filopodia in other cell types and association of reggie-1-EGFP in cell contact sitesHaCaT (A) and FRT (B) cells transfected with WT-FL also show numerous filopodia.(C, D) In HeLa cells transfected with WT-FL, reggie-1 was frequently found enriched in contactsites between two neighbouring cells, often concentrated in zipper-like structures with numerousinterdigitating filopodia. Scale bar: A, B and D, 10 μm; C, 5 μm.

1.c. Indicate Where There Are Induced Filopodia on the Cells in A, B, C, and Dyou can observe…

A B C D Figure 8 Induction of filopodia in other cell types and association of reggie- 1-EGFP in cell contact sites HaCaT (A) and FRT (B) cells transfected with WT-FL also show numerous filopodia. (C, D) In HeLa cells transfected with WT-FL, reggie-1 was frequently found enriched in contact sites between two neighbouring cells, often concentrated in zipper-like structures with numerous interdigitating filopodia. Scale bar: A, B and D, 10 μm; C, 5 μm.

A B C D Figure 8 Induction of filopodia in other cell types and association of reggie- 1-EGFP in cell contact sites HaCaT (A) and FRT (B) cells transfected with WT-FL also show numerous filopodia. (C, D) In HeLa cells transfected with WT-FL, reggie-1 was frequently found enriched in contact sites between two neighbouring cells, often concentrated in zipper-like structures with numerous interdigitating filopodia. Scale bar: A, B and D, 10 μm; C, 5 μm.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 29CTQ: Some autoimmune diseases show a positive correlation with dramatically decreased expression of...

See similar textbooks

Similar questions

Generation of induced pluripotent stem (iPS)cells was first accomplished using retroviral vectors tocarry the OSKM (Oct4, Sox2, Klf4, and Myc) set of tran-scription regulators into cells. The efficiency of fibroblastreprogramming was typically low (0.01%), in part becauselarge numbers of retroviruses must integrate to bringabout reprogramming and each integration event carrieswith it the risk of inappropriately disrupting or activatinga critical gene. In what other ways, or other forms, do yousuppose you might deliver the OSKM transcription regula-tors so as to avoid these problems?
Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.
explain please: Spike-Driven Syncytia Formation Is Coupled to S20 Fragment Generation in the Presence of ACE2. To investigate the functional and biochemical signatures of spike (S) protein upon engaging its receptor ACE2 in live cells, we first utilized a cell–cell fusion assay to obtain potentially cleaved spike protein products from syncytia . In this system, HEK293T cells transfected with plasmids encoding WT spike readily formed syncytia after coculturing with HEK293T cells expressing human and Vero E6-ACE2, as well as colorectal adenocarcinoma Caco-2 and lung adenocarcinoma Calu-3 cells expressing endogenous ACE2. We then collected these adherent syncytia and immunoblotted for cleaved spike species using a rabbit polyclonal antibody specifically detecting the S2 ectodomain through standard reducing Tris-glycine sodium dodecyl sulfate polyacrylamide gel electrophoresis. This experiment revealed that spike expression in HEK293T cells displayed full-length S and autocleaved S2…
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
please give thorough explanation for why answer is B plz do not answer question if u don't actually understand thank you
Pls answer ASAP. Sec61 is a protein involved in the formation of the translocon for ER-targeted proteins. What would happen to the proteins targeted to the Golgi Apparatus in a mammalian cell in which the Sec61 is mutated?
asap please
21:14 +4G KB/S LTED 41 96 09.00 Vo Microsoft Word - Assignment 02.docx Assignment 02 1. Groups of alleles associated with the lactose operon are as follows (in order of dominance for each allelic series): repressor, IS (superrepressor), I *(inducible), and I "(constitutive); operator, OC (constitutive, cis dominant) and 0+ (inducible, cis- dominant); structural, Z and Y. (a) Which of the following genotypes will produce B-galactosidase and B-galactoside permease if lactose is present: (1) 1*0* Z* Y*, (2) 1 *OCZ+ Y+, (3) OCZ+ Y+, (4) IS O+ Z+ Y+, and (5) 10+ Z+Y+? (b) Which of the above genotypes will produce ß-galactosidase and ß-galactoside permease if lactose is absent? Why? 2. By what mechanism does the presence of tryptophan in the medium in which E. coli cells are growing result in premature termination or attenuation of transcription of the trp operon? 3. Suppose that you used site-specific mutagenesis to modify the trpL sequence such that the two UGG Trp codons at positions…
Before JCVI-syn3.0 was produced, what steps were used to create a synthetic Mycoplasma cell? Put the events below into the correct order. Drag and drop the events into the proper sequence from left to right. ▸ View Available Hint(s) First Step Transformed cells are detected by the presence of lacz, which causes them to cleave Xgal and produce a blue color. Yeast is transformed using Mycoplasma mycoides fragments. The synthetic chromosome is transformed into Mycoplasma capricolum. The synthetic Mycoplasma mycoides chromosome is purified. DNA fragments assemble through homologous recombination in yeast. Reset Help Last Step
8:20 ■■ LTE < Spring 2024 - Senior Comprehensives (... Question 6ɔ (ividitudtory) In the Lac operon, what happens when allolactose attaches to the repressor protein? a) b) c) the repressor is induced to attach to the promoter RNA polymerase is induced to attach to the operator lactose synthesis enzymes are produced by genes Z, Y,A d) the repressor is inactivated Question 88 (Mandatory) What is the purpose of X-chromosome inactivation in mammals? a) It accomplishes dosage compensation. b) It assists in the interactions beteeen genes Tra and Dsx. c) It prevents trisomy from occurring. d) It produces the testis determination factor. Question 94 (Mandatory) Duchenne muscular dystrophy is inherited in an X- linked recessive pattern. A female is known to be heterozygous for Du muscular dystrophy XD xd
- 1 attachment If a pure line wheat plant with a colored kernel (geniotype = DDEE) is crossed to plant with white kernels (genotype = ddee) and the resulting. F1 plants are selfed, a modification of the dihybrid 9:3:3:1 ratio will be produced. What is the biochemical explanation for the genotypes: (a) D_E_ and (b) D_ee ? A. Presence of functional enzymes from both genotypes (a) and (b) B. Presence of functional enzymes from genes in (a) C. Absence of a functional enzyme from the D gene pair D. Presence of functional enzymes from genes in (a) and absence of a functional enzyme from the D gene pair in (b) E. None of the above.
In Figure 5-33, which is the rarest λ genotype producedin the initial lysate?