try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNA transcript and use the genetic code to determine the resulting amino acid sequence. Note that the given strands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end with stop codon. 1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________

Q: how many codons would exist in a genetic code that was four bases long (instead of three)

A: DNA consists of four different bases, and the codon is four bases long. So, there will. be 44 number…

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: What anticodon sequences of tRNAs are coded for by the mRNA codons below? (Enter each sequence in 5'…

A: An mRNA molecule's complementary sequence forms a binding with the three nucleotides that make up…

Q: Complete the table. For the polypeptide, use the three-letter code. Note: Reference the Genetic code…

A: The collection of instructions that allow living cells to convert information contained in genetic…

Q: Be sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a.…

A: Normally there is a unidirectional flow of information from DNA to RNA and RNA to proteins. This is…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Multiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate…

A: The process of translation converts the information carried by messenger RNA from DNA into a…

Q: the mRNA and DNA used to synthesize the polypeptide sequence shown and the nucleotides of the tRNA…

A: DNA has two strands. One is called template strand and other is called coding strand. These two…

Q: Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the…

A: A codon is a group of three DNA or RNA nucleotides that codes for a particular amino acid or protein…

Q: Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule…

A: Thank you for the question  Answer The Genes code for proteins. These proteins are the workhorse of…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA 1.…

A: Information coded in the DNA is transcribed in the form of mRNA, these mRNA then translate this…

Q: Translate the following mRNA sequence into the appropriate amino acid sequence.…

A: Messenger RNA is referred to as mRNA. It is a specific kind of RNA (ribonucleic acid) molecule that…

Q: Figure out the mutation. You will need the codon table to answer this question. Wild type DNA…

A: DNA is two strand ladder like structure which consists of :-  A ) Coding strand  B ) Template strand…

Q: AUG is the most common start codon found in translated genes. Which of the following is true of…

A: The start codon is the initial set of codons in an mRNA transcript that is translated by a ribosome.…

Q: Let’s practice making a strand of mRNA. Finish what we started: DNA:…

A: Messenger RNA  is a single-stranded RNA molecule that is complementary to the DNA strand of a gene.

Q: Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know.…

A: Transcription  A process of making of mRNA from DNA. mRNA contain information about polypeptide…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In…

A: Nucleotide is the basic building block of nucleic acids. RNA and DNA are long chains of nucleotides.…

Q: 19. For this question, you will need to use the table for the genetic codes provided on the…

A: From DNA , mRNA is formed and use DNA strand as a template. Produced mRNA goes to cytosol and…

Q: Below is an image of translation occurring in the direction indicated by the arrow. Use the image…

A: An arrow has been given that signifies in which direction, translation is happening. Translation…

Q: tRNA fill in the blanks question different amino acids are used. The amino acids are different tRNA…

A: Transfer RNA, also known by the acronym tRNA and formerly known as soluble RNA (sRNA), is an adaptor…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: The mRNA is produced by the process of transcription. It takes place in the nucleus. The RNA…

Q: Translation work is an essential step for protein synthesis. In order for the protein to be…

A: The expression of genes includes two major process: transcription and translation. In transcription,…

Q: Which process is illustrated in the diagram below? NNNNNNNNNNI Oa replication Ob.RNA processing Oc…

A: DNA synthesis inside the cell occurs when the cell decides to divide. DNA synthesis is carried out…

Q: Some tRNAs can recognize more than one codon because there is a relaxation of the complementation…

A: Translation of mRNA into protein requires a specialized adapter molecule called tRNA and ribosomes.…

Q: Use the mRNA codon table below to answer the question. A tRNA with the anticodon 5' AUG 3' would…

A: tRNA contains a triplet anticodon which pairs with complementary triplet codon present in mRNA…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right…

A: Three parts are solved in case of interlinked question as per our company policy. If you want…

Q: Please answer fast Determine the amino acid sequences for the six open reading frames for this 9…

A: An amino acid is one of the structural blocks of a protein. A gene's DNA grouping decides the order…

Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…

A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…

Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: Fill in the complementary mRNA sequence to the DNA sequence listed below:             DNA sequence…

A: DNA (Deoxyribonucleic acid ) is helical , ladder like structure which is safely present inside the…

Q: Using the following DNA template code, which of the following tRNA anticodons would carry the 4th…

A: Introduction DNA:-  (Deoxyribonucleic acid) It is a long molecule that contains our unique genetic…

Q: Second base of codon C A UUU Phenylalanine UCU UAU UGU Cysteine U Tyrosine tyr y U UUC phe F UCC…

A: The process of protein synthesis is called translation. messenger RNA, transfer RNA and ribosomes…

Q: Translation. Write the anti-codon sequence of the mRNA transcript. Translate the MRNA transcript…

A:

Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…

A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…

Q: Because of the way the genetic code structured, a point mutation in a given codon is likely to have…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: If the nucleotide sequence of an anticodon was AUC, then the DNA triplet would be: O TAG O ATC O AUC…

A: A DNA triplet is a sequence of three consecutive nucleotides that code for a given amino acid. Amino…

Q: 29. Given the DNA sequence, please write the mRNA and then amino acid sequence.…

A: Amino acids are the organic compounds that contain both amino and carboxylic acid as their…

Q: Wobble base pairing allows some tRNAs to bind to more than one type of codon. If wobble base pairing…

A: Francis crick proposed the wobble hypothesis in 1966. According to which : The 5' end of anti-codon…

Q: TATA box is located

A:

Q: For the DNA sequence AATGTCATTGC, what would be the equivalent code for the complimentary RNA…

A: Introduction :- In genetics, a complementary sequence is a sequence of nucleotides that forms base…

Q: 1. Write the mRNA strand that would be created based on the DNA strand below. 2. Write the tRNA…

A: Deoxyribonucleic acid or DNA is the molecule that contains the genetic material in living organisms…