Concept Overview: Protein SynthesisTask 2: Review the process of protein synthesis by placing the cards in their appropriate category.Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledgecheck.TranscriptionTranslationNo Answers ChosenNo Answers ChosenTranscription & TranslationNeitherNo Answers ChosenNo Answers ChosenPossible answersDNA is copied into MRNAInvolves tRNA| Occurs in the mitochondriaInformation in MRNA is used to produce a proteinOccurs in the nucleusInvolves mRNAUtilizes ribosomesInvolves DNA polymeraseInvolves RNA polymeraseOccurs in the cytoplasm::::::::::::

The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Answered: Task 2: Review the process of protein…

Science

Biology

Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Task #3: Design primers 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac cgagacctgg gccggtgagt gcgggtcggg agggaaatgg 121 cctctgccgg gaggagcgag gggaccqcag gcgggggcgc atgacctcag gagccgcgcc 181 gggaggaggg tcgggcgggt ctcagcccct cctcaccccc aggctcccac tccatgtggt 241 atttctacac ctccgtgtcc cggcccqgcc gcggggagcc ccgcttcatc tcagtgggct 301 acgtggacga cacccagttc gtgaggttcg acagcgacgc cgcgagtccg agagaggagc 361 cgcgggcgcc gtggatagag caggaggggc cggagtattg ggaccggaac acacagatct 421 acaaggccca ggcacagact gaccgagaga gcctgcggaa cctgcgcttc tactacaacc 481 agagcgaggc cgttgcqtga ccccqgcccg gggcgcaggt cacgactccc catcccccac 541 gtacggcccg ggtcgccccg agtctccggg tccgagatcc gcctccctga ggccgcggga a) First you'll need to design primers to PCR-amplify amino acids 45-56. i) Record the sequences of the forward and reverse primers, in the 5' to 3' direction. Each primer must be 8 nucleotides long (note that normally primers are much longer than this). Show intermediate steps…
Problem #2 DNA TACT TAA A AAT G A (TS) DNA (CS) MRNA Amino Acids: Please continue to the next page. Activity 2- Reinforcing Protein Synthesis Use your codon chart to determine the amino acid sequence. Read through the strand and ONLY start on AUG and STOP when it tells you to stop. Follow example below: Example: DNA > AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA > UCU GCC AUG GAG GC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG protein > start - glu - ala -thre - hist – asp -glu – threo - stop 1. DNA → CCT CTT TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCCATA ATC MRNA protein > 2 DNA → AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA > pratein > 3. DNA > TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTCGCC ATC MRNA > protein → 4. Fill in the diagram below. DNA MRNA ERNA Amino Acids Please continue to the next page. Universal Genete Code Chart Mensenger RNA Codans and the Amina Asd for Which They Code SECONDBASE…
1
Learning Task 2: Make a model of a DNA template to determine the sequence of bases in th new DNA strands. Then, answer the guide questions that follow. Materials: crayons. Scissors, paste/tape, used folder or illustration board Procedure: Use the pattern of the DNA template: (attached to this LP). Color code, phosphate - blue, deoxyribose sugar = green, nitrogenous base as follows: adenine= yellow, thymine pink, guanine = violet, cytosine = red. And cut the shapes of each nucleotides. Build a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine. %3D %3D Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA. Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the nucieotides for the second strand of the DNA molecules. Match the bases of the first strand and the second strand. Do not tape…
Transcribe the DNA sequence from HbA mRNA: nucleotides: ACGTU
Assignment 9: Transcribing and Translating a Protein Activity 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to transcribe the code into mRNA, remove an intron segment and translate the MRNA into the protein. In addition you will have to identify the beginning fragment, the middle fragment, and the end fragment. Procedure Copy each of the following sequences onto a separate piece of paper. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGT Sequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACT Sequence C TACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG Divide the sequences into triplets (CODONS) by putting a slash between each group of the three bases. Transcribe the DNA into mRNA. Identify the middle…
Question 1: Answer all practice question parts Label the leading and lagging strands below: 3' 5' 5° 3' Label the coding strand and template strand below: A protein is 285 amino acids long. The cell needs 10,000 copies of this protein. Based on this information please answer the following questions. How many ATPS will be needed to make this protein? How many moles of glucose will be needed to make this protein?
PLEASE DRAW thank you!!1
Question questions. : Answer the following A) Compare between the two major types of cells. Also, explain the different levels of interactions between living organisms in the environment. B) Explain why experiments on different kinds of animals may have relevance for understanding human biology, give also, an example of such approach.
Life's Instructions Manual: Discussion Questions 1) Why can the genome be thought of as life's instruction manual? 2) What is the difference between a gene and a genome? 3) What is the difference between DNA and a nucleotide? 4) What builds proteins, and what do proteins do?
PERFORMANCE TASK #2 Name: CELL CYCLE Section: Date: I. PUZZLE SOLVING: Locate ten (10) words that are associated to cellular reproduction in the puzzle. They can be read horizontally, vertically, or diagonally. Write the words in the box. E L CY с E F I A C 0 W B U C I E LN 0 1. 2. T G A M E T E S F I R E F 1 A G H F I S 3. E L ° T M U S с N I 4. P P A о R P I R E V 5. R S I S R T S 0 0 1 6. ° U V I A W ° W ✗ D 7. D Y N S A Z I T E L 8. U G E N E S E H B L 9. с A с E D M U F E 10. E E L с Y C L L E с II. CELLULAR ACTIVITY (MITOSIS): From the choices given below, complete the table by writing the corresponding to the cellular activity that describes the phase indicated. STAGES PHASES CELLULAR ACTIVITIES G₁ phase 1. Interphase S phase 2. G₂ phase 3. Prophase 4. Metaphase 5. Mitosis Anaphase 6. Telophase 7. Cytokinesis 8. DNA replicates Nuclear membrane reforms Cytoplasm completely divides Cellular growth Cell prepares for the actual cell division Chromosomes align at the equatorial plane…
Task #3: Design primers agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac cgagacctgg gccggtgagt gcgggtcggg agggaaatgg 121 cctctgccgg gaggagcgag gggaccgcag gcgggggcgc atgacctcag gagccgcgcc 181 gggaggaggg tcgggcgggt ctcagcccct cctcaccccc aggctcccac tccatgtggt 241 atttctacac ctccgtgtcc cggcccggcc gcggggagcc ccgcttcatc tcagtgggct 301 acgtggacga cacccagttc gtgaggttcg acagcgacgc cgcgagtccg agagaggagc 361 cgcgggcgcc gtggatagag caggaggggc cggagtattg ggaccggaac acacagatct 421 acaaggccca ggcacagact gaccgagaga gcctgcggaa cctgcgcttc tactacaacc 481 agagcgaggc cgttgcgtga ccccggcccg gggcgcaggt cacgactccc catcccccac 541 gtacggcccg ggtcgccccg agtctccggg tccgagatcc gcctccctga ggccgcggga a) First you'll need to design primers to PCR-amplify amino acids 45-56. i) Record the sequences of the forward and reverse primers, in the 5' to 3' direction. Each primer must be 8 nucleotides long (note that normally primers are much longer than this). Show intermediate steps in…