Assignment 9: Transcribing and Translating a Protein Activity 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to transcribe the code into mRNA, remove an intron segment and translate the MRNA into the protein. In addition you will have to identify the beginning fragment, the middle fragment, and the end fragment. Procedure Copy each of the following sequences onto a separate piece of paper. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGT Sequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACT Sequence C TACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG Divide the sequences into triplets (CODONS) by putting a slash between each group of the three bases. Transcribe the DNA into mRNA. Identify the middle end and beginning sequence use your knowledge of start and stop codons to help you figure it out. Remove codons 24 to 66 including codon 66. Translate the MRNA into proteins using the genetic code. ANALYSIS Which fragment was the beginning fragment. How do you know? Which fragment was the end fragment. How do you know? Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for this excision? LAB How many amino acids does this protein contain? Is this genetic sequence eukaryotic or prokaryotic? How do you know? If you worked backward starting with the amino acid sequence of the protein, would you obtain the same DNA nucleotide sequence? Why or why not? Provide the anticodon sequence that would build this protein.
Assignment 9: Transcribing and Translating a Protein Activity
5.4.1 Synthesis of a Protein: A Simulation Activity
In this activity you will be provided with the DNA
Procedure
-
Copy each of the following sequences onto a separate piece of paper.
Sequence A
TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGT
Sequence B
TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACT
Sequence C
TACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
-
Divide the sequences into triplets (CODONS) by putting a slash between each group of the three bases.
-
Transcribe the DNA into mRNA.
-
Identify the middle end and beginning sequence use your knowledge of start and stop codons to help you figure it out.
-
Remove codons 24 to 66 including codon 66.
-
Translate the MRNA into proteins using the genetic code.
ANALYSIS
-
Which fragment was the beginning fragment. How do you know?
-
Which fragment was the end fragment. How do you know?
-
Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for this excision?
LAB
-
How many amino acids does this protein contain?
-
Is this genetic sequence eukaryotic or prokaryotic? How do you know?
-
If you worked backward starting with the amino acid sequence of the protein, would you obtain the same DNA nucleotide sequence? Why or why not?
-
Provide the anticodon sequence that would build this protein.
Step by step
Solved in 2 steps
