Question 4: Explain how a deletion mutation leading to a modification of the 3' untranslated region (UTR) on the CACNA1S mRNA could lead to hypokalemic periodic paralysis without changing the structure of the polypeptide formed? (Note this is not the known cause of hypoKPP, but it makes a good question)

Question 4: Explain how a deletion mutation leading to a modification of the 3' untranslated region (UTR) on the CACNA1S mRNA could lead to hypokalemic periodic paralysis without changing the structure of the polypeptide formed? (Note this is not the known cause of hypoKPP, but it makes a good question)

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Thanks
Primary secondary and tertiary structure of trna l shaped structure is in? What is a benign neoplasm originating from adipose tissue called? Anarobic respiration generally produces amount of energy than aerobic respiration?
Mcm2 is a protein of the helicase complex that recognizes origin in Eukaryotes. But it is also related to cancer progression in humans. Please describe the role of Mcm2 in cancers and the potential uses of its inhibition in cancer treatment.
1st answer choices: yes, no 2: yes, no 3:increase, decrease 4: a lot of mRNA or very little mRNA 5: less mRNA, more mRNA, or the same amount of mRNA
During elongation eEF1α complexed to GTP escorts the aminoacyl tRNA to the ribosome. True False
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.
8.4 Post translational modification The following diagram shows three different types of post translational modification that can occur in proteins. Proteolysis: Phosphorylation: Glycosylation: Cleaving of polypeptide chains The addition of phosphate groups to proteins The addition of sugar groups Label the diagram to demonstrate what type of post-translational modification has taken place to the protein chain. Translation Posttranslational processing eor What organelle is responsible for post translational modification?
Please offer an explanation for the correct answer
Kindly check if this is correct.
In this chapter you were introduced to nonsense suppressor mutations in tRNA genes. However, suppressormutations also occur in protein-coding genes. Using thetertiary structure of the β subunit of hemoglobin shownin Figure 9-3(c), explain in structural terms how a mutation could cause the loss of globin protein function. Nowexplain how a mutation at a second site in the same protein could suppress this mutation and lead to a normalor near-normal protein.
Answer #1 only
39/ 50 Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3' end of the mRNA B It codes for a sequence in eukaryotic transcripts that signals termination of transcription-10-35 nucleotides away C. It allows the 3' end of the mRNA to attach to the ribosome DR is a sequence that codes for the hydrolysis of the RNA polymerase It adds a 7-methylguanosine cap to the 3' end of the mRNA