Homework Help is Here – Start Your Trial Now!
Science
Biochemistry
Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino acids. Your colleague, a biochemist, has purified the protein and determined (via complicated and messy chemical techniques) the sequence of the first 37 amino acids in the protein, which she has reported to you as follows: H2N- MSNITVDDELNLSREQQGFAEDDFIVIKEERETSLSP.... Meanwhile, you have isolated a genomic clone of the gene that codes for the protein, and determined the DNA sequence of the first 227 bases from the 5' end of the gene/transcription unit, as shown below (only the coding/non-template strand is indicated). You know that the ORF begins within this sequence (i.e., that it includes the actual start codon), and comparisons with a CDNA clone have indicated that there is a single intron contained within this region (there also others further downstream, but those are not relevant here). 1 60 5'-GTCTTCCACATCGGCCGCACCCATGAGCAACATAACCGTGGATGACGAGCTCAACTTAAG 61 120 CAGAGAACAGCAAGGTGAGTTCAAGTTCAAAACTATATGAATATACTAGCCGTGCTGATT 121 180 GTCTCTTCCTTCCTTTTTCAGGCTTTGCTGAAGACGATTTCATAGTGATCAAGGAGGAGC 181 227 GCGAGACAAGTCTCTCССССАТАAGGACТАCGCACCCGCAGTTTATA.... 3'

Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino acids. Your colleague, a biochemist, has purified the protein and determined (via complicated and messy chemical techniques) the sequence of the first 37 amino acids in the protein, which she has reported to you as follows: H2N- MSNITVDDELNLSREQQGFAEDDFIVIKEERETSLSP.... Meanwhile, you have isolated a genomic clone of the gene that codes for the protein, and determined the DNA sequence of the first 227 bases from the 5' end of the gene/transcription unit, as shown below (only the coding/non-template strand is indicated). You know that the ORF begins within this sequence (i.e., that it includes the actual start codon), and comparisons with a CDNA clone have indicated that there is a single intron contained within this region (there also others further downstream, but those are not relevant here). 1 60 5'-GTCTTCCACATCGGCCGCACCCATGAGCAACATAACCGTGGATGACGAGCTCAACTTAAG 61 120 CAGAGAACAGCAAGGTGAGTTCAAGTTCAAAACTATATGAATATACTAGCCGTGCTGATT 121 180 GTCTCTTCCTTCCTTTTTCAGGCTTTGCTGAAGACGATTTCATAGTGATCAAGGAGGAGC 181 227 GCGAGACAAGTCTCTCССССАТАAGGACТАCGCACCCGCAGTTTATA.... 3'

Biochemistry
Biochemistry
9th Edition
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Chapter1: Biochemistry: An Evolving Science
Section: Chapter Questions
Problem 1P
See similar textbooks
icon
Related questions
Question

GENETICS please answer questions 19-22 

Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino acids. Your colleague, a biochemist, has purified the protein and determined (via complicated and messy chemical techniques) the sequence of the first 37 amino acids in the protein, which she has reported to you as follows: H2N- MSNITVDDELNLSREQQGFAEDDFIVIKEERETSLSP... Meanwhile, you have isolated a genomic clone of the gene that codes for the protein, and determined the DNA sequence of the first 227 bases from the 5' end of the gene/transcription unit, as shown below (only the coding/non-template strand is indicated). You know that the ORF begins within this sequence (i.e., that it includes the actual start codon), and comparisons with a CDNA clone have indicated that there is a single intron contained within this region (there also others further downstream, but those are not relevant here). 1 60 5'-GTCTTCCACATCGGCCGCACCCATGAGCAACATAACCGTGGATGACGAGCTCAACTTAAG 61 120 CAGAGAACAGCAAGGTGAGTTCAAGTTCAAAACTATATGAATATACTAGCCGTGCTGATT 121 180 GTCTCTTCCTTCCTTTTTCAGGCTTTGCTGAAGACGATTTCATAGTGATCAAGGAGGAGC 181 227 GCGAGACAAGTCTCTCCCCCATAAGGACTACGCACCCGCAGTTTATA.... 3'
Transcribed Image Text:Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino acids. Your colleague, a biochemist, has purified the protein and determined (via complicated and messy chemical techniques) the sequence of the first 37 amino acids in the protein, which she has reported to you as follows: H2N- MSNITVDDELNLSREQQGFAEDDFIVIKEERETSLSP... Meanwhile, you have isolated a genomic clone of the gene that codes for the protein, and determined the DNA sequence of the first 227 bases from the 5' end of the gene/transcription unit, as shown below (only the coding/non-template strand is indicated). You know that the ORF begins within this sequence (i.e., that it includes the actual start codon), and comparisons with a CDNA clone have indicated that there is a single intron contained within this region (there also others further downstream, but those are not relevant here). 1 60 5'-GTCTTCCACATCGGCCGCACCCATGAGCAACATAACCGTGGATGACGAGCTCAACTTAAG 61 120 CAGAGAACAGCAAGGTGAGTTCAAGTTCAAAACTATATGAATATACTAGCCGTGCTGATT 121 180 GTCTCTTCCTTCCTTTTTCAGGCTTTGCTGAAGACGATTTCATAGTGATCAAGGAGGAGC 181 227 GCGAGACAAGTCTCTCCCCCATAAGGACTACGCACCCGCAGTTTATA.... 3'
Questions 19-22: Based on the information presented above (and relevant info from your textbook, including the genetic code and the splice site consensus sequences), you should be able to: A) relate the amino acid sequence to the DNA sequence, and thereby B) unambiguously identify the intron vs. exon sequences in the genomic DNA. After doing so, answer the following: 19) How large is the intron (give the exact length/number of bases)? 20) What is the number of the FIRST base in the intron (i.e., the base at/adjacent to the 5' splice site)? (Give the exact number, using the numbering system indicated on the figure above). 21) What is the number of the "branchpoint" nucleotide? (i.e., the invariant "A" which gets linked to the 5' end of the intron in the "lariat" when the RNA is spliced.) 22) Design a pair of "exon-specific" PCR primers (each with 17 bases) that would precisely amplify the entire first exon of the gene from genomic DNA (starting with the first base indicated above). Questions 23-24: A transition mutation that affects the FIRST base in the intron (i.e., as indicated in problem 12) prevents splicing. Determine the amino acid sequence that would result if this unspliced mutant mRNA is translated, and then answer the following: Second letter A G UUU Phe UCU UAU Tyr UGU U Cys UGC (Č) UAA Stop UGA Stop UAG Stop | UGG Trp G (W) UUC (F) UCC Ser UAC (Y) 23) How many amino acids (in total) are present in the mutant polypeptide? UUA UCA (S) A Leu UUG (L) UCG 24) What is the last (C-terminal) amino acid in the mutant polypeptide? CUU CCU CAU His CGU U CÚC Leu cCC Pro CAC (H) CUA (L) CGC Arg (R) ССА (Р) САА CGA Gln CUG G CAG (Q) CGG AUU ACU AAU Asn AGU Ser Пе AUC (I) (S) ACC AAC (N) AGC Thr A AUA ACA (T) AAA AGA Lys AAG (K) Arg AGG (R) AUG Met ACG First letter > U AG Third letter
Transcribed Image Text:Questions 19-22: Based on the information presented above (and relevant info from your textbook, including the genetic code and the splice site consensus sequences), you should be able to: A) relate the amino acid sequence to the DNA sequence, and thereby B) unambiguously identify the intron vs. exon sequences in the genomic DNA. After doing so, answer the following: 19) How large is the intron (give the exact length/number of bases)? 20) What is the number of the FIRST base in the intron (i.e., the base at/adjacent to the 5' splice site)? (Give the exact number, using the numbering system indicated on the figure above). 21) What is the number of the "branchpoint" nucleotide? (i.e., the invariant "A" which gets linked to the 5' end of the intron in the "lariat" when the RNA is spliced.) 22) Design a pair of "exon-specific" PCR primers (each with 17 bases) that would precisely amplify the entire first exon of the gene from genomic DNA (starting with the first base indicated above). Questions 23-24: A transition mutation that affects the FIRST base in the intron (i.e., as indicated in problem 12) prevents splicing. Determine the amino acid sequence that would result if this unspliced mutant mRNA is translated, and then answer the following: Second letter A G UUU Phe UCU UAU Tyr UGU U Cys UGC (Č) UAA Stop UGA Stop UAG Stop | UGG Trp G (W) UUC (F) UCC Ser UAC (Y) 23) How many amino acids (in total) are present in the mutant polypeptide? UUA UCA (S) A Leu UUG (L) UCG 24) What is the last (C-terminal) amino acid in the mutant polypeptide? CUU CCU CAU His CGU U CÚC Leu cCC Pro CAC (H) CUA (L) CGC Arg (R) ССА (Р) САА CGA Gln CUG G CAG (Q) CGG AUU ACU AAU Asn AGU Ser Пе AUC (I) (S) ACC AAC (N) AGC Thr A AUA ACA (T) AAA AGA Lys AAG (K) Arg AGG (R) AUG Met ACG First letter > U AG Third letter
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 4 steps with 2 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Medical terminologies
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781319114671
Author:
Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:
W. H. Freeman
Lehninger Principles of Biochemistry
Lehninger Principles of Biochemistry
Biochemistry
ISBN:
9781464126116
Author:
David L. Nelson, Michael M. Cox
Publisher:
W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul…
Fundamentals of Biochemistry: Life at the Molecul…
Biochemistry
ISBN:
9781118918401
Author:
Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:
WILEY
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305961135
Author:
Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:
Cengage Learning
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
Fundamentals of General, Organic, and Biological …
Fundamentals of General, Organic, and Biological …
Biochemistry
ISBN:
9780134015187
Author:
John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:
PEARSON
SEE MORE TEXTBOOKS