Homework Help is Here – Start Your Trial Now!
Science
Biology
Questions 19-22: Based on the information presented above (and relevant info from your textbook, including the genetic code and the splice site consensus sequences), you should be able to: A) relate the amino acid sequence to the DNA sequence, and thereby B) unambiguously identify the intron vs. exon sequences in the genomic DNA. After doing so, answer the following: 19) How large is the intron (give the exact length/number of bases)? 20) What is the number of the FIRST base in the intron (i.e., the base at/adjacent to the 5' splice site)? (Give the exact number, using the numbering system indicated on the figure above). 21) What is the number of the "branchpoint" nucleotide? (i.e., the invariant "A" which gets linked to the 5' end of the intron in the "lariat" when the RNA is spliced.)

Questions 19-22: Based on the information presented above (and relevant info from your textbook, including the genetic code and the splice site consensus sequences), you should be able to: A) relate the amino acid sequence to the DNA sequence, and thereby B) unambiguously identify the intron vs. exon sequences in the genomic DNA. After doing so, answer the following: 19) How large is the intron (give the exact length/number of bases)? 20) What is the number of the FIRST base in the intron (i.e., the base at/adjacent to the 5' splice site)? (Give the exact number, using the numbering system indicated on the figure above). 21) What is the number of the "branchpoint" nucleotide? (i.e., the invariant "A" which gets linked to the 5' end of the intron in the "lariat" when the RNA is spliced.)

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

GENETICS

please answer questions 19-24 

Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino acids. Your colleague, a biochemist, has purified the protein and determined (via complicated and messy chemical techniques) the sequence of the first 37 amino acids in the protein, which she has reported to you as follows: H2N- MSNITVDDELNLSREQQGFAEDDFIVIKEERETSLSP... Meanwhile, you have isolated a genomic clone of the gene that codes for the protein, and determined the DNA sequence of the first 227 bases from the 5' end of the gene/transcription unit, as shown below (only the coding/non-template strand is indicated). You know that the ORF begins within this sequence (i.e., that it includes the actual start codon), and comparisons with a CDNA clone have indicated that there is a single intron contained within this region (there also others further downstream, but those are not relevant here). 1 60 5'-GTCTTCCACATCGGCCGCACCCATGAGCAACATAACCGTGGATGACGAGCTCAACTTAAG 61 120 CAGAGAACAGCAAGGTGAGTTCAAGTTCAAAACTATATGAATATACTAGCCGTGCTGATT 121 180 GTCTCTTCCTTCCTTTTTCAGGCTTTGCTGAAGACGATTTCATAGTGATCAAGGAGGAGC 181 227 GCGAGACAAGTCTCTCCCCCATAAGGACTACGCACCCGCAGTTTATA.... 3'
Transcribed Image Text:Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino acids. Your colleague, a biochemist, has purified the protein and determined (via complicated and messy chemical techniques) the sequence of the first 37 amino acids in the protein, which she has reported to you as follows: H2N- MSNITVDDELNLSREQQGFAEDDFIVIKEERETSLSP... Meanwhile, you have isolated a genomic clone of the gene that codes for the protein, and determined the DNA sequence of the first 227 bases from the 5' end of the gene/transcription unit, as shown below (only the coding/non-template strand is indicated). You know that the ORF begins within this sequence (i.e., that it includes the actual start codon), and comparisons with a CDNA clone have indicated that there is a single intron contained within this region (there also others further downstream, but those are not relevant here). 1 60 5'-GTCTTCCACATCGGCCGCACCCATGAGCAACATAACCGTGGATGACGAGCTCAACTTAAG 61 120 CAGAGAACAGCAAGGTGAGTTCAAGTTCAAAACTATATGAATATACTAGCCGTGCTGATT 121 180 GTCTCTTCCTTCCTTTTTCAGGCTTTGCTGAAGACGATTTCATAGTGATCAAGGAGGAGC 181 227 GCGAGACAAGTCTCTCCCCCATAAGGACTACGCACCCGCAGTTTATA.... 3'
Questions 19-22: Based on the information presented above (and relevant info from your textbook, including the genetic code and the splice site consensus sequences), you should be able to: A) relate the amino acid sequence to the DNA sequence, and thereby B) unambiguously identify the intron vs. exon sequences in the genomic DNA. After doing so, answer the following: 19) How large is the intron (give the exact length/number of bases)? 20) What is the number of the FIRST base in the intron (i.e., the base at/adjacent to the 5' splice site)? (Give the exact number, using the numbering system indicated on the figure above). 21) What is the number of the "branchpoint" nucleotide? (i.e., the invariant "A" which gets linked to the 5' end of the intron in the "lariat" when the RNA is spliced.) 22) Design a pair of "exon-specific" PCR primers (each with 17 bases) that would precisely amplify the entire first exon of the gene from genomic DNA (starting with the first base indicated above). Questions 23-24: A transition mutation that affects the FIRST base in the intron (i.e., as indicated in problem 12) prevents splicing. Determine the amino acid sequence that would result if this unspliced mutant mRNA is translated, and then answer the following: Second letter A G UAU Tyr UGU Cys UGC (C) UUU Phe UCU UUC (F) UCC Ser UAC (Y) 23) How many amino acids (in total) are present in the mutant polypeptide? UUA Leu UCA (S) UAA Stop UGA Stop A UAG Stop UGG Trp (W) UUG (L) UCG 24) What is the last (C-terminal) amino acid in the mutant polypeptide? CUU CCU CAU His CGU ссC Pro Leu CGC Arg CUC CAC (H) CUA (L) ССА (Р) САА CGA (R) Gln CAG (Q) CUG CCG CGG AUU ACU AAU Asn AGU Ser (S) Пе AUC (I) AUA АСС Thr (N) AAC AGC ACA (T) AAA AGA AUG Met ACG (M) Lys AAG (K) Arg AGG (R) GCU GAU Asp (D) GUU GGU GUC Val GCC Ala GAC GGC Gly GUA (V) GCA (A) GAA Glu GGA (G) GUG GCG GAG (E) GGG G First letter Third letter
Transcribed Image Text:Questions 19-22: Based on the information presented above (and relevant info from your textbook, including the genetic code and the splice site consensus sequences), you should be able to: A) relate the amino acid sequence to the DNA sequence, and thereby B) unambiguously identify the intron vs. exon sequences in the genomic DNA. After doing so, answer the following: 19) How large is the intron (give the exact length/number of bases)? 20) What is the number of the FIRST base in the intron (i.e., the base at/adjacent to the 5' splice site)? (Give the exact number, using the numbering system indicated on the figure above). 21) What is the number of the "branchpoint" nucleotide? (i.e., the invariant "A" which gets linked to the 5' end of the intron in the "lariat" when the RNA is spliced.) 22) Design a pair of "exon-specific" PCR primers (each with 17 bases) that would precisely amplify the entire first exon of the gene from genomic DNA (starting with the first base indicated above). Questions 23-24: A transition mutation that affects the FIRST base in the intron (i.e., as indicated in problem 12) prevents splicing. Determine the amino acid sequence that would result if this unspliced mutant mRNA is translated, and then answer the following: Second letter A G UAU Tyr UGU Cys UGC (C) UUU Phe UCU UUC (F) UCC Ser UAC (Y) 23) How many amino acids (in total) are present in the mutant polypeptide? UUA Leu UCA (S) UAA Stop UGA Stop A UAG Stop UGG Trp (W) UUG (L) UCG 24) What is the last (C-terminal) amino acid in the mutant polypeptide? CUU CCU CAU His CGU ссC Pro Leu CGC Arg CUC CAC (H) CUA (L) ССА (Р) САА CGA (R) Gln CAG (Q) CUG CCG CGG AUU ACU AAU Asn AGU Ser (S) Пе AUC (I) AUA АСС Thr (N) AAC AGC ACA (T) AAA AGA AUG Met ACG (M) Lys AAG (K) Arg AGG (R) GCU GAU Asp (D) GUU GGU GUC Val GCC Ala GAC GGC Gly GUA (V) GCA (A) GAA Glu GGA (G) GUG GCG GAG (E) GGG G First letter Third letter
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Learning & Memory
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS