The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.

Q: If the following truncated peptide represents the active domain of the COVID19’s S-protein…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: Help me figure out how I should interpret and read these graphs. We are looking to see whether the…

A: The regulation of RNA splicing is a complex process that involves the interaction of multiple…

Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…

A: Hi dear, here's your answer.please like it .

Q: In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then…

A: Introduction The secretory pathway refers to the endoplasmic reticulum, Golgi apparatus and the…

Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC   By in vitro translating the mRNA, you…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of formation of protein using the information encoded in the mRNA. mRNA…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids…

A: Lactose permease Its belong to transmembrane protein family. The transport mechanism of lactose…

Q: Many blood clotting proteins undergo a post-translational modification in which specific glutamic…

A: Post Translational Modifications (PTM) of such complexity is only observed in eukaryotes and not in…

Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…

A: Transcription is the process  in which mRNA (messenger RNA ) is made from DNA which further…

Q: All of the following are needed for capping of eukaryotic mRNA, EXCEPT   Question 27 options:…

A: Eukaryotic mRNA is a single-stranded ribonucleic acid. This is associated with the protein…

Q: Each type of molecule listed below is recognized by a specific class of nuclear import receptor…

A: Importin and exportin refer to the nuclear transport receptors that are responsible for the…

Q: Order the following choices to indicate the sequence of steps in the process of elongation of a…

A: The following are necessary for prokaryote polypeptide synthesis to begin: mRNA, the 30S ribosome…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that…

A: mRNA Messenger RNA or mRNA, it is a single-stranded RNA molecule that is coded into chain of peptide…

Q: (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given…

A: RNA strnad given = 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' (i) DNA strand from which this mRNA is…

Q: T F T F T T F F The major bonds in cellulose are a(1-4) bonds. Answer: During mRNA splicing, U2…

A: Introduction :- mRNA splicing is a post-transcriptional process in which introns (non-coding…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…

Q: Suppose that a protein has the amino acid sequence…

A: Researchers need to take the degeneracy of the genome's code into account to calculate the amount of…

Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…

A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.