The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known repeating sequences were used as mRNAs to direct protein synthesis in cell - free extracts . What type or types of polypeptides would you expect to be synthesized if poly (AAG) n (A) AAGAAGAAG ) used as the template for in vitro peptide synthesis ?

Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…

A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…

Q: Which amino acid sequence will be generated during translation from the following small mRNA:…

A: According to the hint given then the start codon is AUG (Met) The stop codon is UGA .

Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: Christian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high…

A: In the 1950s, Christian Anfinsen performed a series of studies. He discovered that all the…

Q: A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of…

A: The protein is an extremely complex substance which consist of amino acid residues jointed by…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Considering that genes can code only for RNA orproteins, how can the synthesis of nonprotein…

A: A gene is the basic physical and functional unit of heredity. They are made up of DNA.

Q: (a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the…

A: Proteins are the biological polymers of amino acids. They are formed by peptide bonds by polypeptide…

Q: Consider the following in light of the concept of levels of structure (primary, secondary, tertiary,…

A: In double stranded DNA structure two strands run in anti-parallel directions through base pairing…

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of…

A: The probability that a protein molecule is completely error free is (1-δ)n, where n is the number of…

Q: Why would the mutation Ile -> Asp be likely to destabilize a protein? Why would the mutation Ile…

A: Mutations in proteins' amino acid sequences can have an impact on their stability. Long sequences of…

Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…

A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: You are in the process of determining theamino acid sequence of a protein and must reconcile…

A: In the first trial, the protein has glycine at the amino terminal while asparagine at the carboxyl…

Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…

A: Transcription is the process  in which mRNA (messenger RNA ) is made from DNA which further…

Q: Consider the following DNA sequence, which codes for a short polypeptide:…

A: A codon is a sequence of three nucleotides (in DNA or mRNA) that specifies a particular amino acid…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: The following are sequences from three different alpha helices found in human proteins:…

A: The proteins are constituted of twenty naturally occurring amino acids connected via peptide…

Q: Use the following DNA sequence, and write the resulting messenger RNA sequence

A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…

Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.