Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…
A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…
Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…
A: In eukaryotic organisms, the gene contains introns as well as exons. Eukaryotic genomes are much…
Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…
A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…
Q: Which of the following set(s) of primers a-d could you use to amplify the following target DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: of hnRNA into mature mRNA incl
A: hnRNA can be defined as heterogeneous nuclear RNA. It also refers to the large pre‐mRNAs consisting…
Q: If there are multiple start condo, how can you identify the real start codon? By observing Okazaki…
A: Transcription and translation are specialized events that are part of the central dogma i.e. DNA to…
Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…
A: Gene expression is a process by which genetic information from a gene is used for the production of…
Q: Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also…
A: Hypothesis is basically a proposed explanation for any naturally occurring phenomenon in the…
Q: What molecules are largely responsible for the universal feature of the genetic code?…
A: DNA is the store house of genetic information. This genetic information is expressed in the form of…
Q: What molecular biology strategy can best be used to determine Inhibition of the splicing of one…
A: In eukaryotic genes, introns exist. They are interstitial sequences (80-10,000 bp). They do not code…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: Genetics is the study of how traits are passed from one generation to another. This includes but is…
Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…
A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…
Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…
A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…
Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…
A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…
Q: Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow…
A: Splicing is the post transcriptional modification where intron (non coding part of gene) will be…
Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…
A: The central dogma of life includes the following processes: Replication: In this process, the DNA…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…
Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…
A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: Alternative splicing is a process that enables a messenger RNA to direct the synthesis of different…
Q: An important validation of the genetic code occurred when George Streisinger determined the amino…
A: It is given that the specific single-base insertion mutation could be suppressed, with wild-type…
Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…
A: Alternative splicing is a method through which a messenger RNA may control the creation of many…
Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…
A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…
Q: As we described in class, in the early 1960's Francis Crick and colleagues set out to determine how…
A: Introduction Genetic code The sequence of bases that encodes a functional protein molecule is…
Q: The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base…
A: Genetic codes are triplet, ambiguous, degenerate and non-overlapping. Three bases codes for an amino…
Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…
A: Genetic codon It is a group of three nucleotide that code for amino acids. They are total 64…
Q: A particular transposable element generates flanking direct repeats that are 4 bp long. Give the…
A: Transposons are the DNA sequences capable of changing its position or location within the genome of…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…
Q: Select all of the factors in the list below that play a role in the translation initiation of…
A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: A particular transposable element generates flanking direct repeats that are 4 bp long. Give the…
A: The sequence of DNA that changes position in the genome, at times reverses or creates mutations,…
Q: An ORF 1,200 bp in length can encode a protein of what size?
A: Proteins Proteins are the building block of our body they are synthesized by the process of…
Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…
A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…
Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: Transcription is the process which are answerable for integrating the RNA from the DNA by the…
Q: Explain why a minimum of 32 tRNAs are required to translate the “standard” genetic code.
A: Genetic code is considered degenerate, where several amino acids are encoded by more than just one…
Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…
A: The nucleotides in RNA (ribonucleic acid) or DNA (deoxyribonucleic acid) sequence are read as…
Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Q: Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap…
A: Inside the cells of any organism, RNA is considered an essential biomolecule as it performs a…
Q: Based on this alignment, you can identify areas of the protein sequences that are key regions of the…
A: Multiple sequence alignment is used to obtain optimal matching between three or more sequences of…
Q: A mutation is found in a tRNA-encoding gene. The wild type allele produces a tRNA that recognizes…
A: The translation is a process by which the proteins are synthesized. Proteins are important for the…
Q: Many antibiotics are effective as drugs to fight off bacterial infections because they inhibit…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. If you need help with other sub…
Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…
A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…
Q: A novel, RNA-containing splicing factor is purified on the basis of its physical interaction with a…
A: Splicing is the process by which the non-coding regions (introns) are excised from the newly…
Q: The human genome contains thousands of sequences known as small open reading frames, some of which…
A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…
Q: The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Consider the following sequence fragment of an mRNA. Which of the miRNAS below would be competent…
A: A miRNA is a small single-stranded non-coding RNA molecule found in various organism including…
Q: What is the concept of universality of the genetic code? What are the exceptions to this…
A: As we know that there are four nucleotide bases i.e. the A, T, G, C which are arranged in the form…
Q: Enzymes in which the catalytic portion is not made of protein include all of the following except:…
A: Ribozymes (ribonucleic acid enzymes) are RNA molecules that have the ability to catalyze specific…
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainKnowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.
- Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
- Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?The following DNA sequences found on the sense strand belong to the same eukaryotic gene: Sequence 1: 5'-GATTCAATAAAGCTCAGATCGCTCACGTCGCGACTC-3' Sequence 2: 5'-TCCGAGGTCACTAGATACTCGTCGATCGTATAAATG-3' a) Which sequence is likely to be found upstream from the coding sequence? Justify your answer. b) Which sequence is likely to be found downstream from the coding sequence? Justify your answer. c) Which sequence will not be transcribed into an mRNA transcript? Justify your answer.Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'
- We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)