What enzyme catalyzes protein synthesis in bacteria? You discover a new broad-spectrum antibiotic that inhibits protein synthesis and named it Compound J. You want to determine the mechanism of action of Compound J. After treating bacteria cells with Compound J, you observe many ribosomes with long polypeptide chains bound to them. Based on this observation, make a hypothesis about which part of the ribosome Compound J is binding and how this specifically affects translation. What evidence supports that proper protein folding is essential to all domains of life? Name and describe the function/s of two specific molecules that help proteins fold in bacteria.

Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…

A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…

Q: Which of the following parts of translation is significantly different in eukaryotes and…

A: mRNA or messenger RNA carries genetic information as nucleotide sequence copied from template DNA…

Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…

A: Introduction  In the protein translation process, the key role is played by the tRNA which…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: The piece of RNA below includes the region that codes for the binding site for the initiator tRNA…

A: Translation is a fundamental process in molecular biology that converts the genetic information…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of…

A: The protein is an extremely complex substance which consist of amino acid residues jointed by…

Q: Actinomycin D inhibits DNA-dependent RNA synthesis. This antibiotic is added to a bacterial culture…

A: Antibiotics are isolated from microorganisms (bacteria). They use antibiotics to inhibits the growth…

Q: Consider the following peptide sequence: Met-Ser-Val-Thr-Ile-Lys-Ala-Cys-Leu-Ser-lle-Tyr-Phe-Ser…

A: Structure of a protein or a peptide is described in four levels: primary, secondary, tertiary and…

Q: Translation requires energy what step(s)? please explain answer B) 30S ribosome subunit binding C)…

A: Translation is the process that involves production of polypeptide chain from the mRNA (messenger…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Explain the function of the Shine-Dalgarno sequence in prokaryotic protein translation. Where is it…

A: The process by which prokaryotic cells, such as bacteria, synthesise proteins based on genetic…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Use the table to answer:   A portion of an mRNA attached to a ribosome reads: 5′…

A: Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two…

Q: Based on the diagram, what can you conclude about how the chloramphenicol behaves as an antibiotic?

A: Chloramphenicol is a broad-spectrum antibiotic whose spectrum includes several gram-positive and…

Q: Which of the following would base pair with an aminoacyl tRNA? Question 33 options: A) 5'-UGA-3'…

A: Aminoacyl-tRNA is tRNA to which it's cognate amino acid is chemically bound. The Aminoacyl-tRNA…

Q: Order the following choices to indicate the sequence of steps in the process of elongation of a…

A: The following are necessary for prokaryote polypeptide synthesis to begin: mRNA, the 30S ribosome…

Q: Why chaperones are particularly important when translation occurs on membrane-bound ribosomes ?

A: Protein translation either occurs in cytosol by free ribosomes and some proteins gets translated on…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: the chemical group responsible for nucleophilic attack in translational elongation is  a) free…

A: Translation:        It involves decoding a messenger (mRNA) and using it's information to build a…

Q: Which of the following are stages of translation?

A: The translation is the process of converting the information in mRNA to Proteins. Ribosome which has…

Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…

A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.