The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA triplets encoding the translation initiation (or start) codon and a stop codon are included in the sequence. 3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5' 5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3' a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine the amino acid sequence of the polypeptide (use three letter codes for the amino acids) and identify the N- and C- terminal ends of the polypeptide.
The following segment of DNA in a hypothetical model organism encodes a polypeptide containing
SEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA triplets
encoding the translation initiation (or start) codon and a stop codon are included in the sequence.
3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'
5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'
a. Label which of the DNA strands is the template strand and which is coding strand.
b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine the
amino acid sequence of the polypeptide (use three letter codes for the amino acids) and
identify the N- and C- terminal ends of the polypeptide.
please help. I am confused.
c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules
(like water)? Place a circle around these.
d. Some amino acids on a polypeptide can be modified post-translationally. These
modifications may have some effect on the function of the protein. State three modifications
that can occur and explain the effect of that modification on the protein.

Step by step
Solved in 2 steps









