How many open reading frames are present in the following mRNA sequence? You may find the codon table helpful.   5' AAUGGGAAUUCCCGAUGAAUAUAATCGTCCTGCATUGAUGGUCCAUGCAAGU 3'OH

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: A TRNA molecule with the anticodon UGC would be carrying the amino acid: Second base of codon…

A: tRNA brings its amino acid to the mRNA in a specific order. This specific order can be determined by…

Q: RNA codon table 2nd position G 1st A 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Cys…

A: Three consecutive nitrogen base on mRNA is called genetic code which determine a specific amino…

Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…

A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC   By in vitro translating the mRNA, you…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Use the genetic code below to determine the third amino acid in the protein translated from the…

A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by the…

Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…

A: In transcription, the template strand is the strand of DNA that serves as the template for the…

Q: A poison added to an in vitro translation mixture containing mRNA molecules with the sequence 5'-…

A: In the process of protein synthesis, when the ribosome encounters the start codon (AUG) and…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: eseg pL oseg sy non UCC UAU sko C. UAC UGA dos UGG UUA UCA UAA dois dois CGU ne UAG UCG dil CAU CUC…

A: Genetic code The combination of three nucleotides called codon . Each codon codes for an amino acid…

Q: The following RNA polymer is added to an E. coli extract, where it can be translated in all three…

A: A reading frame is the sequence of nucleotides in a nucleic acid (DNA or RNA) molecule read into a…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: The following eukaryotic DNA is transcribed into RNA and the mRNA transcript is translated into…

A: mRNA:  Messenger RNA (mRNA) is a type of RNA molecule that carries genetic information from the DNA…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: how do you translate this sequence RNA A C U G U C A U G A G C C C U G C A…

A: Translation is the process by which proteins are synthesized by the ribosomes after the process of…

Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3'…

A: The production of peptide chain or protein from the mRNA is known as translation that occurs within…

Q: 5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere…

A: A cell "reads" the information in a messenger RNA (mRNA) during translation and uses it to create a…

Q: What is the sequence of the mRNA molecule synthesized from the DNA template strand…

A: The genetic information stored in DNA is copied to an mRNA through a process known as transcription.…