5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of the coding sequence: Write the double-stranded DNA sequence that corresponds to the MRNA above. Label 5' and 3' ends. Would transcription have occurred using the top or bottom strand as the template? Imagine you discover a mutation in the DNA, within the coding sequence of the corresponding mRNA above. You determine that the mutation does not result in a change to amino acid sequence. What is the most likely reason for this?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.


Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 1 images









