Please answer A, B, and C for codon sequence 6 only The image displays six sequences of DNA. Each sequence is labeled with a number from 1 to 6 and presented in the 5' to 3' direction. Notable nucleotides are highlighted in different colors, indicating their significance or differences within the sequences.1. **Sequence 1**: - 5' - TACCC**G**AGATAATATATACGCTGCACATAT**ATG**GACACCCGATTATAAAGATATC**TAG**TGCCGCGAGAATTATAG - 3' - The nucleotide 'G' is highlighted in orange. The triplet 'ATG' is in green, and 'TAG' is in red.2. **Sequence 2**: - 5' - TACCCAGATAATATATACGCTGCACATAT**ATG**GACAC**A**GATTATAAAGATATC**TAG**TGCCGCGAGAATTATAG - 3' - 'A' is highlighted in orange. The triplet 'ATG' is green, 'TAG' is red.3. **Sequence 3**: - 5' - TACCCAGATAATATATACGCTGCACATAT**ATG**GACACCCGATTA**T**AAAGATATC**TAG**TGCCGCGAGAATTATAG - 3' - 'T' is highlighted in orange. The triplet 'ATG' is green, 'TAG' is red.4. **Sequence 4**: - 5' - TACCCAGATAATATATACGCTGCACATAT**ATG**GACACCCGATTAA**A**GATATC**TAG**TGCCGCGAGAATTATAG - 3' - 'A' is highlighted in orange. The triplet 'ATG' is green, 'TAG' is red.5. **Sequence 5**: - 5' - TACCCAGATAATATATACGCTGCACATAT**ATG**GACACCCGATTATAAAAGA**T**ATC**TAG**TGCCGCGAGAATTATAG - 3' - 'T' is highlighted in orange. The triplet 'ATG' is green, 'TAG' is red **Transcription of DNA Sequence and Mutation Analysis Assignment****DNA Sequence Information:**Use the sequence of DNA below as your reference point; this single-stranded DNA sequence is the coding strand of a gene, which means the mRNA sequence is identical (not complementary) to this sequence except that T’s are replaced with U’s. You do not have to convert any part of the DNA sequence into a complementary strand for this part of the assignment – you should just use the DNA sequence as given.*Note: for simplicity, not every sequence needed for gene expression is included in this gene – for example, you won’t necessarily find a Shine Dalgarno sequence in the mRNA 5’ UTR. Use only the information labeled on the DNA sequence to answer each question.***DNA Sequence with Labels:**5’ - TACCAGATAAATATATACCGCATGCACACATATGGCACGATTATAAAGATATCTAGTGCCGCGAGAATTTATAG - 3’- **Promoter**- **5’ UTR**- **Coding Region**- **3’ UTR**- **Transcription start site**: Marked just before the sequence- **Translation start codon**: ATG- **Translation stop codon**: TAG (highlighted in red)**Assignment Instructions:**For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all examples, the mutation is highlighted in orange. A codon table is provided on the second page for your reference. Answer each of the following questions for EACH DNA sequence:A) **What type of mutation is shown based on the nature of the genetic change** (frameshift mutation or point mutation; if a point mutation, transition or transversion)B) **What type of mutation is shown based on the functional impact on the organism** (frameshift, silent, missense, nonsense, noncoding)C) **What do you predict the effect of that mutation will be on either the structure or function of a protein, or on the phenotype of the organism. Explain your answer.** *For this part, there are some examples where you should know exactly the effect of the mutation, and some where you may have to infer this information based on the location of the mutation.*

Name: Please answer A, B, and C for codon sequence 6 only The image displays
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Please answer A, B, and C for codon sequence 6 only The image displays six sequences of DNA. Each sequence is labeled with a number from 1 to 6 and presented in the 5' to 3' direction. Notable nucleotides are highlighted in different colors, indicati

A mutation is a known as a change to an organism's DNA sequence. A single nucleotide is altered by point mutations, which is present in the above case. A). Based on the nature of genetic change it is a point mutation. where A is replaced by G. GAGAA →GAGGA B). Based on the functional impact on the organism. The mutation is present in non-coding region after stop codon before which translation ends.C) The 3'UTR regulates gene expression by a coordinated interaction between the mRNAs' structural elements (cis-elements) and certain trans-acting factors (RNA binding proteins and non-coding RNAs).Examples were somatic mutations in the 3'-UTR of GATA4, which leads to malformed hearts.In another instance, where Myotonic dystrophy is caused due to an increased number of trinucleotide (CTG) repeats in the 3'-UTR of the gene encoding the dystrophia myotonica protein kinase (DMPK).