**DNA Transcription and Translation Exercise**A small strand of DNA has this sequence:```TACCGGAAACTGATGGCCTTTGAC```a. **mRNA Synthesis** If the **TOP** strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made?b. **Eukaryotic Transcription** If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed?c. **Protein Synthesis** What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?---**Explanation:**This exercise involves understanding the processes of transcription and translation in molecular biology. Students are expected to navigate the conversion of DNA to mRNA and subsequently to protein, taking into account the mechanics of RNA processing in eukaryotic cells. **Universal Genetic Code Chart***Messenger RNA Codons and the Amino Acids for Which They Code*This chart is a visual representation of the mRNA codons and the corresponding amino acids they code for. It is organized in a table format divided by three bases: the first base, second base, and third base.### Table Structure:1. **First Column (First Base)**: Represents the first base of the mRNA codon. It comprises four nucleotides: U, C, A, and G.2. **Top Row (Second Base)**: Represents the second base with four nucleotides: U, C, A, and G.3. **Right Column (Third Base)**: Highlights the third base with the same nucleotide arrangement: U, C, A, and G.4. **Central Grid (Codons and Amino Acids)**: Contains combinations of codons based on the intersections of the first, second, and third bases. Each codon corresponds to an amino acid or a stop signal.### Key Codon to Amino Acid Pairings:- **UUU, UUC**: Phenylalanine (PHE)- **UUA, UUG; CUU, CUC, CUA, CUG**: Leucine (LEU)- **AUU, AUC, AUA**: Isoleucine (ILE)- **AUG**: Methionine (MET) or Start Codon- **GUU, GUC, GUA, GUG**: Valine (VAL)- **UCU, UCC, UCA, UCG**: Serine (SER)- **CCU, CCC, CCA, CCG**: Proline (PRO)- **ACU, ACC, ACA, ACG**: Threonine (THR)- **GCU, GCC, GCA, GCG**: Alanine (ALA)- **UAU, UAC**: Tyrosine (TYR)- **CAU, CAC**: Histidine (HIS)- **AAU, AAC**: Asparagine (ASN)- **GAU, GAC**: Aspartic Acid (ASP)- **UGU, UGC**: Cysteine (CYS)- **UGG**: Tryptophan (TRP)- **UGA, UAA,

Name: **DNA Transcription and Translation Exercise**A small strand of DNA h
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: **DNA Transcription and Translation Exercise**A small strand of DNA has this sequence:```TACCGGAAACTGATGGCCTTTGAC```a. **mRNA Synthesis** If the **TOP** strand is the template strand, what will be the mRNA made from this DNA read from left to ri