Which direction is upstream (left or right)? Possible Answers: A. Right - the promoter lies downstream of the transcription start site B. Left - the promoter lies upstream of the transcription start site C. Right - the promoter lies upstream of the transcription start site D. Left - the promoter lies downstream of the transcription start site
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. Be sure to explain your answer for each question.
5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’
3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’
Which direction is upstream (left or right)?
Possible Answers:

Step by step
Solved in 5 steps with 1 images









