Use the genetic code to answer these questions.Second letterUAGUCU)UCCUGU)CysUAU Tyr UGccysUGC.UUUUPheUACUUCUUUASer}LeUCAUAA Stop UGA Stop | ALeuUUG.UCGUAG Stop UGG TrpGCCUСССCAU1CGUCGCArgCUUCÁCHISProCUCLeuCUAССАСААCGACCGCAG GlnCUGCGGAAU AsnAGUAUUACUSerAUC ileAAUAАACAAAC JThrAAA LysAGCJArgAGAAUG Met | ACGAAGJAGG.GCUGUU)GUCGGUAGAUAspGACJGGU)GGCGlyGCC- ValAlaGCAGAAGGAGCGGluGAGSGGGGUGGQ3.1Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding to the coding strand (the one that would bemade by RNA polymerase reading the template strand). Label the 5' and 3' termini.Coding strand5'- ТАTGAAATTТAAATTT - 3'Template strand3'— АТАСТТТАААТTТАAA - 5'Enter your answer hereFirst letterDUAGThird letterDUAG

Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAATTТAAATTT - 3' Template strand 3'- АТАСТТТАAАТTTAAA - 5'

Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAATTТAAATTT - 3' Template strand 3'- АТАСТТТАAАТTTAAA - 5'

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

What is the sequence of the newly synthesize DNA segment if the template strand has the following sequence:3'-ATGGCCTATGCGAT-5'
The following nucleotide sequence is found on the template strand of DNA. First, determine the amino acids of the protein encoded by this sequence by using the genetic code provided in Figure 15.10. Then give the altered amino acid sequence of the protein that will be found in the following mutations: Q.Mutant 2: A transition at nucleotide 13
When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand and MRNA codon? O DNA template is 3'-UGA-5. MRNA codon is 5'-ACT-3' O DNA template is 5'-ACU-3'. MRNA codon is 3'-TGA-5'. O DNA template is 3'-ACU-5'. mRNA codon is 5'-TGA-3' O DNA template is 3'-TGA-5'. MRNA codon is 5'-ACU-3' 1 Previous Next
Refer to the DNA template strand below. Which of the following corresponds to the protein coding sequence portion of the corresponding mRNA? 5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3' O 5'- ATG CGA TTT GGG TGC TAG - 3' O 5' - AUG CGA UUU GGG UGC - 3' O 3' - GAC AUA GGA UCG UGG GUU UAG - 5' O 5' - CTA GCA CCC AAA TCG CAT TAG - 3' O 3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5'
The following nucleotide sequence is found on the template strand of DNA. First, determine the amino acids of the protein encoded by this sequence by using the genetic code provided in Figure 15.10. Then give the altered amino acid sequence of the protein that will be found in the following mutations: Q.Mutant 4: A T S A transversion at nucleotide 15
If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = arginine
The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the sequence of the double-stranded DNA that encoded the mRNA. Label the DNA 5’ & 3’ ends, and which strand of DNA is the template strand and which is the non-template strand.
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many total hydrogen bonds are in this double strand of DNA? Template : P- AGACTTG-OH New strand :
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
Please answer A, B, and C for codon sequence 2 only