Use the genetic code to answer these questions.Second letterUAGUCU)UCCUGU)CysUAU Tyr UGccysUGC.UUUUPheUACUUCUUUASer}LeUCAUAA Stop UGA Stop | ALeuUUG.UCGUAG Stop UGG TrpGCCUСССCAU1CGUCGCArgCUUCÁCHISProCUCLeuCUAССАСААCGACCGCAG GlnCUGCGGAAU AsnAGUAUUACUSerAUC ileAAUAАACAAAC JThrAAA LysAGCJArgAGAAUG Met | ACGAAGJAGG.GCUGUU)GUCGGUAGAUAspGACJGGU)GGCGlyGCC- ValAlaGCAGAAGGAGCGGluGAGSGGGGUGGQ3.1Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding to the coding strand (the one that would bemade by RNA polymerase reading the template strand). Label the 5' and 3' termini.Coding strand5'- ТАTGAAATTТAAATTT - 3'Template strand3'— АТАСТТТАААТTТАAA - 5'Enter your answer hereFirst letterDUAGThird letterDUAG

Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAATTТAAATTT - 3' Template strand 3'- АТАСТТТАAАТTTAAA - 5'

Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAATTТAAATTT - 3' Template strand 3'- АТАСТТТАAАТTTAAA - 5'

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Sequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTA
Transcribe the following DNA sequence. Then translate the resulting mRNA transcript. GGACTACGTTCAAAAGCCATGGATTCGGTA Transcription: Translation: What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.) a) nucleotide number 16 changes from a G to an A b) nucleotide number 12 changes from an A to a T c) nucleotide number 8 changes from a G to an A d) an insertion of a C between nucleotides 14 and 15.
The following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…
The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'
can someone help
In your own words
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.
c) Based on your answer to part b above, determine the polypeptide sequence produced by the ribosome from the mRNA which you transcribed
Give the sequence of the LEFT (5'-end) region of this RNA strand that would participate in forming the stem of a stem-loop with this bit of RNA. DRAW this stem-loop in your scratch work! 5’-UGGUGGAUCUCUGCAACUGAUCCAUUG-3’
given the following DNA template, write out the cDNA, mRNA, tRNA anticodons, and give the amino acid sequence. what are the three possible outcomes if there ws a base substitution mutation were to occur to the template? template TAC CGC TCC GCC GTC GAC AAT ACC ACT
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'