sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence  5’-TAT-GGC-ATG-3’?       Ile-Arg-Pro     His-Ala-Ile     Tyr-Gly-Met     Val-Arg-Tyr     Ile-Pro-Tyr

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…

A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…

Q: Explain how the use of radiolabeled aminoacids in this procedure helped to reveal the genetic code.

A: Introduction  In 1964, two eminent scientists Marshall W. Nirenberg and Philip Leder carried out the…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: Draw a segment of DNA that has the 5’-TAGC-3’ sequence and its complementary strand

A: Please find the image below. The sequence with molecular details is given as follows.  The question…

Q: Which biochemicals wash up on beaches? O No answer text provided. O No answer text provided. Choose…

A: Beaches contain organisms made up of DNA and DNA is made of polynucleotide chains.

Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…

A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…

Q: Choose the correct answer from the list. is a DNA binding site. protects coding sequences at the 5'…

A: All these terms are related to synthesis of biomolecules by the processes such as transcription and…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…

Q: How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'

A: DNA stands for Deoxyribonucleic acid. It is a molecule composed of two polynucleotide chains to form…

Q: Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify…

A: Note- according to our guild line we are supposed to answer only one question. Please repost the…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: One DNA strand has the sequence  5' -ATTCCGTAGC-3' what is the complementary strand sequence?

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…

A: DNA replication :-  It is the formation of a new DNA from a pre existing DNA.  The DNA so formed is…

Q: Give typing answer with explanation and conclusion  Which of the triplets below is a possible…

A: Production of protein from the mRNA is known as translation in which tRNA is responsible for…

Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…

A: DNA serves as the genetic material and carries genetic information from one generation to another.…

Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?

A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: Using the straight-chain sugar convention where the vertical lines represent sugars and the…

A: DNA is the genetic material in all living organisms and it is made up of thymine, adenine, guanine,…

Q: The template strand of a segment of double-helical DNA contains the sequence –…

A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is the genetic…

Q: Based on the work presented in Boch et al., 2009 Science, choose all of the DNA sequences that can…

A: Many bacteria's pathogenicity is dependent on the injection of effector proteins into eukaryotic…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: Take the following DNA sequence and use it for protein synthesis. 3' AACGGTCCTATATACCC 5' What is…

A: DNA to Protein Synthesis: This process is based on the central dogma of molecular biology, which…

Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’   a. Complementary Strand b. Direct…

A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…

Q: From the following DNA template, which sequence is synthesized by RNA Polymerase?    5’- T  – C – C…

A: According to the central dogma of molecular biology, the information stored in DNA is first…

Q: The type of DNA replication error illustrated in the diagram below is _______________________

A: Frameshift mutation .

Q: Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding…

A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Q: DNA Transcription and Translation Directions: 1. Transcribe the DNA sequences below into MRNA. Read…

A: mRNA sequence: 3'C A U A G G G A A C U G A A G U U U C C C G G G U A C U U C C C A5'

Q: Escherichia coli DNA sequence that cc

A:

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…

Q: Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the…

A: Open reading frame is a part of genetic material which is responsible for expressing itself in the…

Q: lence: -T -G FG -A If RNA primase used this section of DNA to make a primer, what would be the…

A: RNA primase is an enzyme used in DNA replication. It produces RNA primer.

Q: Give the sequence of the LEFT (5'-end) region of this RNA strand that would participate in forming…

A: Answer: STEM LOOP = It is the hairpin loop , It occurs when the two regions of the same strand are…

Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…

A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…

Q: Why is a primase needed for DNA replication? Multiple Choice O O Primases are needed to convert DNA…

A: DNA replication is a complex process that ensures the faithful transmission of genetic information…

Q: Determine the complementary DNA strand that would form. Next, write the mRNA that would form from…

A: DNA or deoxyribonucleic acid is a double stranded helical macromolecule that is composed of…

Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC

A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.