For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCGGUUAAGCG - 3' Second Letter UUU Phe ucU u UuC UUA UGU Cys u UGC Stop UGA Stop Stop UGG Trp G UAU Ser UAC Tyr uc UCA UcG UAA Leu UUG UAG CU c Cuc CUA CUG CU Leu CCC CCA cG CAU CÁC CAA CAG His CGU CGC Arg Pro Gin CGA 1st 3rd CGG AGU | Ser u letter AGC AGA AGG letter AAU AAC AUU ACU Asn A AUC le ACC Thr AUA ACA AAA Lys Аrg AUG Met ACG AAG GAU GAC GCU Val GCC GCA GCG GUU Asp GGU GGC Gly G GUC GUA GUG Ala GAA GGA Glu GAG GGG

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: What are the particular changes in the gene and protein sequences shown on the screen? Name the…

A: Mutation is the sudden change of a gene or chromosome from one to another. position 3 wild type…

Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…

A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…

Q: de, translate the mRNA into an amino acid sequence.

A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…

A: In transcription, the template strand is the strand of DNA that serves as the template for the…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: ginine rine ginine cine Third letter DCAG UCAG UCAG

A: There are 64 possible codon out of which 3 codon do not code for any amino acid.  Thus 61 codon code…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Place sequences a, b and c into the correct order based on start and stop codons. Sequence A…

A: Introduction  Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: Which letter in the image represents the end product and the process of translation

A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…

A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: What would happen if you changed the anticodon in the Tryptophan tRNA from ACC to AAC?

A: The process of translation is essentially reading the message sent from DNA in the form of mRNA by…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: Use the following DNA sequence, and write the resulting messenger RNA sequence

A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…