Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid would be what

Q: what is the adenine content

A: In double-stranded DNA, 3 hydrogen bonds form between guanine and cytosine and make them a pair. On…

Q: The DNA sequence you use will be the following:  T - A - G - C - C - A.  You will need to make the…

A: chargaff's rule states that in DNA sequence in  complementary strands the Adenine will form a bond…

Q: Which letter represents the following structures: (0.5X6) Okazaki fragment Replication fork Leading…

A: The given image is representing the process of DNA replication that occurs inside the cell before…

Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…

A: The DNA double helix has alternating major and minor grooves. The major groove is wider than the…

Q: Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify…

A: Note- according to our guild line we are supposed to answer only one question. Please repost the…

Q: What would be the problem if ATT was inserted into the DNA template strand after the second codon?…

A: The DNA is the double-stranded nucleic acid called deoxyribonucleic acid found in the nucleus of the…

Q: If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became…

A: A point mutation or substitution is a form of genetic mutation where a 1 single nucleotide base is…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: a group of three nucleotides codes for one amino acid. these groups of three nucleotides are called…

A: Amino acids are the building blocks of proteins. They are organic compounds that contain an amino…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: Draw a 4-N base strand of DNA with all four N-base sequences represented

A: Introduction :  Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the…

Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Choose a pentapeptied composed of five different amino acids.  List the five amino acids.…

A: mRNA strand is synthesized from the template strand of the DNA by transcription. This mRNA is…

Q: Write the complementary sequence of DNA AGCTAT AGC

A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense…

A: A nonsense mutation is one in which change in nucleotide will result in a stop codon. This will…

Q: How many codons would exist in a genetic code that had codons that were four bases long? Why? (show…

A: The rules governing the encoding of genetic information in the DNA of living things are known as the…

Q: Using the straight-chain sugar convention where the vertical lines represent sugars and the…

A: DNA is the genetic material in all living organisms and it is made up of thymine, adenine, guanine,…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…

Q: Describe the d=features of the following DNA-binding domains and how they interact with DNA.…

A: DNA-binding domain abbreviated as DBD is a protein domain that is folded independently and contains…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…